ID: 1129336311

View in Genome Browser
Species Human (GRCh38)
Location 15:74854208-74854230
Sequence GGGAGTCCCCTCACAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129336311_1129336319 -6 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336319 15:74854225-74854247 ACTCCCTCGGGGCCTGCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 133
1129336311_1129336328 30 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336311_1129336318 -7 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336318 15:74854224-74854246 GACTCCCTCGGGGCCTGCACTGG 0: 1
1: 0
2: 2
3: 4
4: 142
1129336311_1129336323 7 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129336311 Original CRISPR GGGAGTCCCCTCACAGGCAG GGG (reversed) Intronic