ID: 1129336311

View in Genome Browser
Species Human (GRCh38)
Location 15:74854208-74854230
Sequence GGGAGTCCCCTCACAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129336311_1129336318 -7 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336318 15:74854224-74854246 GACTCCCTCGGGGCCTGCACTGG 0: 1
1: 0
2: 2
3: 4
4: 142
1129336311_1129336328 30 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336311_1129336323 7 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336311_1129336319 -6 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336319 15:74854225-74854247 ACTCCCTCGGGGCCTGCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129336311 Original CRISPR GGGAGTCCCCTCACAGGCAG GGG (reversed) Intronic
900256107 1:1699055-1699077 GGGAAGCTCCTCACGGGCAGAGG + Intronic
900264775 1:1751665-1751687 GGGAAGCTCCTCACGGGCAGAGG + Exonic
900321918 1:2088721-2088743 TGGAGGCCCCTCCCAGGCGGCGG + Intronic
900517449 1:3089612-3089634 GGGGAGCCCCTCACCGGCAGGGG - Intronic
900580127 1:3404674-3404696 TGGGGTCCCCTCCCGGGCAGAGG + Intronic
900691253 1:3981990-3982012 GCGGGGACCCTCACAGGCAGTGG + Intergenic
901449400 1:9326761-9326783 GGAAGGCCCCTCAGAAGCAGCGG - Intronic
903179487 1:21598083-21598105 GGGAGCCACCTCACTGGCCGCGG + Intronic
904417827 1:30373830-30373852 GTGAGTCCCCTCCCAGGCTGTGG - Intergenic
904587591 1:31588718-31588740 GGGATCCCCCTCCCAGGCACAGG - Intergenic
907247271 1:53116175-53116197 GGCAGGGCCCTCACAGGCGGTGG - Intronic
907869000 1:58426003-58426025 GGGAGAGCCCTTACAGGGAGTGG + Intronic
908468679 1:64420493-64420515 GGGTTTCCCCTCACAGGCTTAGG + Intergenic
912545753 1:110450246-110450268 GGGGCTTCCCTCACAGGCGGAGG + Intergenic
915590151 1:156866224-156866246 GATAGGCCCCTCAGAGGCAGAGG + Intronic
916827251 1:168454076-168454098 AGGAATGTCCTCACAGGCAGGGG - Intergenic
919409388 1:197225600-197225622 GGGAGTCTCCTCAAAAGCGGAGG + Intergenic
921300619 1:213748230-213748252 GGAAGTCCCCTCTCAGGTAAAGG - Intergenic
922905509 1:229170688-229170710 GGAAGTGCCCTTAGAGGCAGGGG - Intergenic
923541820 1:234893681-234893703 GGGAGACAGCTCACAGCCAGAGG + Intergenic
1062834539 10:627116-627138 GGTGGTCCCCGCACACGCAGTGG + Intronic
1062957162 10:1547903-1547925 GGGAGGCCCCTGACAGGCCTGGG + Intronic
1066975902 10:42367614-42367636 CGGTGTCGCCACACAGGCAGGGG + Intergenic
1067275955 10:44834327-44834349 GGTACTTCCCACACAGGCAGTGG + Intergenic
1069589991 10:69635625-69635647 GGGTGGCCCCGCAGAGGCAGTGG - Intergenic
1069682390 10:70294536-70294558 GGCAGTTCTCTCACAAGCAGAGG + Intergenic
1070635150 10:78119587-78119609 GGGTGTCACTTTACAGGCAGAGG + Intergenic
1072953899 10:99872235-99872257 GGGAGTACCCTCACCCCCAGAGG - Intergenic
1073617971 10:105017232-105017254 GGAGGTCCCCACACAGGAAGTGG + Intronic
1075522941 10:123154826-123154848 GGGGGTCCCCCCAGAGGGAGGGG - Intronic
1076527005 10:131118195-131118217 AGCAGTCCGCTCACAAGCAGTGG + Intronic
1076547755 10:131257219-131257241 GGCTGGCCCCTCCCAGGCAGTGG - Intronic
1078856461 11:15209418-15209440 GGGACACCCAGCACAGGCAGAGG - Intronic
1081936164 11:46905347-46905369 GGGAGTCCCATCACATGGAGTGG - Intronic
1083419398 11:62544766-62544788 GGGATTTCCCTCACGGGGAGGGG + Intronic
1084196658 11:67526553-67526575 GGGGGTGGCCTCACAGACAGAGG + Intergenic
1084468740 11:69342857-69342879 GGGGGTCCCCGCCCAGGCAGTGG + Intronic
1084512056 11:69612149-69612171 GGGAGTCCTCTCCAAGGCTGGGG - Intergenic
1089563350 11:119357021-119357043 GGGAGCCTCCCCACGGGCAGCGG + Intronic
1090455004 11:126841567-126841589 GGCTGTGCCCTCAAAGGCAGAGG + Intronic
1091658735 12:2364980-2365002 TGTAGGCCACTCACAGGCAGGGG - Intronic
1096272572 12:50177868-50177890 GGGAGACCCCTCACAGCCCAGGG - Exonic
1102180629 12:110909909-110909931 GGCAGTGCCCTCAGAGGCTGGGG - Intergenic
1102455824 12:113070325-113070347 GGGAGTCCCACCACAGGCTGAGG - Intronic
1103390729 12:120571215-120571237 GGGACTGCCCTGACTGGCAGTGG - Exonic
1104675488 12:130709561-130709583 GGGGCTCCCCTCTCAGGGAGAGG + Intronic
1106015070 13:25861581-25861603 GGGAATCCCCTAAGAGACAGTGG + Intronic
1106226397 13:27790023-27790045 GGGAGCCCCCTCTCCGGCCGCGG + Intergenic
1106940976 13:34778950-34778972 GAGAAACCCCTCACAGCCAGGGG - Intergenic
1108370106 13:49760748-49760770 GGAAATACCCTCACAGGCACTGG - Intronic
1110418780 13:75280982-75281004 GGCAGACTCCACACAGGCAGTGG + Intergenic
1117517576 14:56517621-56517643 GGAAGTGCCCTCAAAGGGAGAGG - Intronic
1118362727 14:65069743-65069765 GGGAGCCCCCACAGAGTCAGTGG - Intronic
1119018405 14:71084286-71084308 GGGAGACGCCTCCCGGGCAGGGG - Intronic
1120799125 14:88669515-88669537 GGGAGGCCCCGCACAGTGAGGGG - Intronic
1121104840 14:91273222-91273244 AGGAGTCCCCTCAGAAGCTGGGG - Exonic
1121247709 14:92474371-92474393 TGGAAGCCCCTCGCAGGCAGGGG - Intronic
1122036299 14:98951459-98951481 GGGAGACAACTCAAAGGCAGAGG + Intergenic
1122721751 14:103726178-103726200 AGGGGTTCCCTCACAGGCGGGGG + Intronic
1123063467 14:105604944-105604966 AGGAGTCCCCTCGCTGTCAGGGG + Intergenic
1123473402 15:20570859-20570881 GGGAGACCGCTCAGAGGAAGAGG + Intergenic
1123665924 15:22609402-22609424 GGGAGACCGCTCAGAGGAAGAGG - Intergenic
1123733701 15:23165870-23165892 GGGAGACCGCTCAGAGGAAGAGG + Intergenic
1123751830 15:23363245-23363267 GGGAGACCGCTCAGAGGAAGAGG + Intronic
1124284198 15:28387169-28387191 GGGAGACCGCTCAGAGGAAGAGG + Intronic
1124298499 15:28524445-28524467 GGGAGACCGCTCAGAGGAAGAGG - Intronic
1124319746 15:28703815-28703837 GGGAGACCGCTCAGAGGAAGAGG - Intronic
1124520811 15:30405603-30405625 GGGAGACCGCTCAGAGGAAGAGG - Intronic
1124537849 15:30560616-30560638 GGGAGACCGCTCAGAGGAAGAGG + Intronic
1124544305 15:30612677-30612699 GGGAGACCGCTCAGAGGAAGAGG + Intronic
1124760805 15:32446970-32446992 GGGAGACCGCTCAGAGGAAGAGG - Intronic
1124777829 15:32602093-32602115 GGGAGACCGCTCAGAGGAAGAGG + Intronic
1126436498 15:48644166-48644188 GGGATTCCCATGACAGTCAGAGG - Intronic
1127571845 15:60251287-60251309 GGGATTCCCATCACCAGCAGAGG + Intergenic
1127772841 15:62244602-62244624 GGGAGACCAGTCACAGGAAGAGG - Intergenic
1128450604 15:67804032-67804054 GTGAGGCACCTCACAGGCTGGGG - Intronic
1128823187 15:70681063-70681085 GGGAGAAGCCTCACAGGCTGAGG - Intronic
1128827109 15:70729520-70729542 GTGGGTCCCTTCACAGGCGGCGG - Intronic
1129318629 15:74761617-74761639 GGCAGTCCCCTCTCAGGGACAGG - Intergenic
1129336311 15:74854208-74854230 GGGAGTCCCCTCACAGGCAGGGG - Intronic
1129781713 15:78276684-78276706 TGTAGTCCCCTCACTGGCCGTGG + Intronic
1129888580 15:79056047-79056069 GGGAGCACCCTCTGAGGCAGGGG + Intronic
1132239283 15:100245241-100245263 CAGAATCCCCTCGCAGGCAGGGG + Intronic
1132381367 15:101368959-101368981 GTGAGACCTCCCACAGGCAGAGG + Intronic
1132868946 16:2107059-2107081 GGGAGTGAGCTCACCGGCAGTGG - Intronic
1133185079 16:4090134-4090156 TGGAGTCCCCTCCAAGTCAGGGG - Intronic
1134826688 16:17290471-17290493 AGGAGACGCCTTACAGGCAGGGG + Intronic
1136990711 16:35149798-35149820 GGGAATCCCCCCACAGGTATGGG - Intergenic
1139267955 16:65657270-65657292 GGGATTCAGCTCACAGGCATAGG - Intergenic
1139484208 16:67247030-67247052 GGGAGTCCCCTCTCAAGTTGAGG - Intronic
1139532406 16:67548850-67548872 GGGAGGCCCCTGTGAGGCAGAGG - Intergenic
1140188978 16:72798232-72798254 GGGAGACCCCACTCTGGCAGAGG - Exonic
1140246456 16:73254139-73254161 GGGACTCCTCTAACAGGCAATGG + Intergenic
1140464146 16:75165829-75165851 AGGAGTCCCAGCAGAGGCAGTGG - Intronic
1141896813 16:86963600-86963622 CAGAGTCCCCTCACAGCCCGCGG - Intergenic
1142154799 16:88528061-88528083 AGGAGTCCCCCCGCAGGCACCGG - Exonic
1144395307 17:14837470-14837492 GGGTGTCCCCTCAGACTCAGGGG + Intergenic
1146167417 17:30600776-30600798 CGGAGTCACCACAGAGGCAGGGG - Intergenic
1147218697 17:38915512-38915534 GGGAGGCCCCTCAGAGGCAGGGG - Intronic
1148132493 17:45270529-45270551 GGGATCTCCCTCACAGGCGGAGG + Exonic
1148330676 17:46812198-46812220 GGGAATTCCCTCTCTGGCAGCGG + Intronic
1148820073 17:50355079-50355101 AGGGGTCCCCTCCCATGCAGAGG - Intronic
1152358182 17:79816547-79816569 GGGGGTCACCCCATAGGCAGGGG + Intergenic
1152641754 17:81452249-81452271 GGGAGGCCCCCCAGAGGCAGTGG + Intronic
1152938235 17:83152827-83152849 GGGGCTCCGCTCACAGGGAGAGG + Intergenic
1153002037 18:464474-464496 GGAAGTCCCCAGACAGTCAGTGG - Intronic
1155522882 18:26686771-26686793 AAGAGTCCCCTCACAGTAAGAGG + Intergenic
1160538760 18:79609384-79609406 GCCAGTCCCCTCACAGACACTGG - Intergenic
1160819470 19:1051312-1051334 GGAGGTCACCTCACAGGGAGGGG + Intronic
1161571107 19:5031271-5031293 GGGAGGCCCCGCGCAGTCAGAGG + Intronic
1162041659 19:7974618-7974640 GGCTGCCCCTTCACAGGCAGAGG - Intronic
1162491531 19:10995417-10995439 AGGAGCCCCCACAAAGGCAGGGG - Intronic
1162645950 19:12050543-12050565 TTGAGACACCTCACAGGCAGCGG + Intronic
1163104517 19:15115751-15115773 GGGAGCCTCCTCTCTGGCAGAGG - Intronic
1163288763 19:16365079-16365101 TGGAATGCCATCACAGGCAGTGG + Intronic
1163804420 19:19386967-19386989 GGGACTCCCCTCAGAGGCGGGGG - Intronic
1165923641 19:39314150-39314172 GGGGGTGCCATCAGAGGCAGAGG + Exonic
1166071941 19:40393078-40393100 AGAAGTGCCCTCACCGGCAGAGG + Intergenic
1168233434 19:55047364-55047386 GTGAGTCCCCTCCCAGCCTGGGG - Intronic
1168708096 19:58480969-58480991 GGCAGTCACCCCACAGGCACTGG - Exonic
926060192 2:9800329-9800351 AGGTGTCCTCTCCCAGGCAGGGG - Intergenic
926913552 2:17873041-17873063 GGCAGTGTCCTCACAGGAAGAGG - Intergenic
927552547 2:24011911-24011933 AGGAGTCACCTTCCAGGCAGAGG + Intronic
927842645 2:26455313-26455335 AGGAGTCCCCTCCCCGTCAGAGG + Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
934907382 2:98217078-98217100 GGGGTTCCCCTCAATGGCAGAGG + Intronic
935810399 2:106791680-106791702 GGGAGTGACCTCAAGGGCAGTGG - Intergenic
945101537 2:206266875-206266897 TGGGGTGCCCTCTCAGGCAGTGG + Intergenic
946357244 2:219195642-219195664 GGCAGGCCCCTGAAAGGCAGAGG + Intronic
948827480 2:240579639-240579661 GGGTGTCCACTCCCAGGCAGGGG - Exonic
1169901130 20:10552550-10552572 GGCAGTCCCCTCCCCCGCAGGGG - Intronic
1170080060 20:12464727-12464749 GGGTGACCCCAGACAGGCAGAGG - Intergenic
1171272548 20:23828005-23828027 GGGAGACACCTGGCAGGCAGTGG + Intergenic
1173750239 20:45470373-45470395 GGGCCTCCCCTCCCAGGCACAGG + Exonic
1174111470 20:48200877-48200899 GGGGGTCCCCTTCCAGGCTGGGG - Intergenic
1174571313 20:51503704-51503726 TGAAGGCCCCTCCCAGGCAGAGG - Intronic
1175502832 20:59462365-59462387 GGGAGGAGCCTCTCAGGCAGAGG + Intergenic
1178511300 21:33207175-33207197 GGGAGGAACCTCTCAGGCAGAGG - Intergenic
1179219035 21:39390195-39390217 TGGAGTCACCTCAAAAGCAGTGG + Intronic
1179598620 21:42460745-42460767 GGGAGTCCCATCAGAATCAGAGG - Intergenic
1180867122 22:19126096-19126118 GGGCGTCCCTTCTGAGGCAGCGG - Intergenic
1181256235 22:21564583-21564605 GGGAGTCATCTTGCAGGCAGCGG + Intronic
1183213929 22:36467202-36467224 GGGAGCTGCCTCCCAGGCAGGGG - Exonic
1184419894 22:44373727-44373749 GGGAGGCCTCTCCCTGGCAGTGG - Intergenic
1184475771 22:44720493-44720515 GTGAGACCCCTTCCAGGCAGAGG - Intronic
949834612 3:8254436-8254458 GGCACTCCCCTCACTGACAGAGG + Intergenic
954622905 3:52005866-52005888 GGGGGTTCCCTGACAGGAAGTGG + Intergenic
954994043 3:54865686-54865708 GGAAGTTCCTTCACAGGCAAAGG - Intronic
956671560 3:71696340-71696362 GGCAGTCCCCAAACAGGCTGGGG - Intronic
959063935 3:101638772-101638794 GGTAGTCTCCCCAGAGGCAGTGG - Intergenic
960406546 3:117267653-117267675 GGAATTCTCCTCACAGGCACTGG - Intergenic
961504285 3:127359885-127359907 GGAAGGGCCCCCACAGGCAGGGG + Intergenic
961649334 3:128409714-128409736 GGGAGTCGGCTCCTAGGCAGAGG - Intergenic
967123705 3:186406331-186406353 GGGAGGCCCAGCACTGGCAGGGG - Intergenic
969239469 4:5889173-5889195 TGGAGCCCCCTAACTGGCAGAGG + Intronic
969599474 4:8167405-8167427 GGGAGGCCCCTGGCAGGCAGGGG - Intergenic
970318148 4:14849019-14849041 GGGAGTCCCATCCCATCCAGAGG + Intergenic
970921900 4:21404118-21404140 GGGAGAGCCCCCCCAGGCAGAGG - Intronic
973775542 4:54238137-54238159 GGAAGGCTCCTCACAGGAAGGGG - Intronic
975134535 4:70861775-70861797 GGGACTCCTGTCCCAGGCAGAGG + Intergenic
976401410 4:84611108-84611130 GGGAGGACCATCACAGGCAGAGG + Intronic
985038779 4:185867820-185867842 GGGAGTCCCCAGAGAGGCTGGGG + Intronic
993770265 5:91917353-91917375 GGCAGGCCCCGCACAGGGAGCGG + Intergenic
998297601 5:140986509-140986531 GCCAGTTCCCTCACAGGCAGGGG - Intronic
999427642 5:151501302-151501324 GGGAGACACCACGCAGGCAGTGG - Intergenic
999427885 5:151503487-151503509 GGGAGACACCACGCAGGCAGTGG - Intergenic
1007373208 6:41440334-41440356 GGGAGCAGCCTGACAGGCAGAGG - Intergenic
1011640536 6:89412554-89412576 CGTGGTCCCCGCACAGGCAGGGG + Intergenic
1018261875 6:161978522-161978544 GGGTGTCATCTCACAGACAGTGG + Intronic
1019171200 6:170134217-170134239 GGGAGCCCCATCACATGCAGGGG + Intergenic
1019418184 7:936903-936925 GGGAGTCCCCCACCAGCCAGGGG - Intronic
1022159418 7:27693888-27693910 GGGAGACCCCTGAGAGGTAGAGG + Intergenic
1023619483 7:42055353-42055375 GAGACTCCCCACACAGGCTGTGG - Intronic
1023983464 7:45082417-45082439 GGGGGTCCTGGCACAGGCAGGGG + Exonic
1024541071 7:50475541-50475563 GGGCTTCCCCTCAAAGGCATGGG - Intronic
1025212024 7:57025270-57025292 GGGAGGCGCCTTACAGGCAGAGG + Intergenic
1025659930 7:63551558-63551580 GGGAGGCGCCTTACAGGCAGAGG - Intergenic
1025692694 7:63760342-63760364 GGGAGTCCGCTGTGAGGCAGAGG - Intergenic
1034802222 7:154061603-154061625 GGGACTCCCATCACAGGGGGGGG + Intronic
1035079239 7:156202556-156202578 GGGAGTTCCCACACCTGCAGGGG + Intergenic
1035141681 7:156768892-156768914 AGGAGTCCACTCGGAGGCAGTGG + Intronic
1035204921 7:157289132-157289154 GAGAGTCACCTCCCAGCCAGAGG + Intergenic
1035324463 7:158055998-158056020 CGGACTCCACCCACAGGCAGTGG - Intronic
1037597223 8:20364269-20364291 GTGAGGCCACTCAGAGGCAGTGG + Intergenic
1037876085 8:22549215-22549237 GGGAGGCCCCTCTTAGACAGGGG + Intronic
1040284765 8:46094099-46094121 TGGAGGACCCCCACAGGCAGTGG + Intergenic
1041731645 8:61068860-61068882 GGGAGACCCTTCCTAGGCAGAGG - Intronic
1045840306 8:106572087-106572109 GCCACTCCCATCACAGGCAGAGG - Intronic
1049577630 8:143397063-143397085 GGGAGTTCCCTCGATGGCAGTGG - Intergenic
1049698371 8:143994650-143994672 GTGTGTCCCCACACTGGCAGAGG - Intronic
1051540841 9:18215768-18215790 GGGAGTGACCTTAAAGGCAGGGG + Intergenic
1051943473 9:22537144-22537166 GGGAGTCCCTTCGCTGGTAGAGG - Intergenic
1053429058 9:38030029-38030051 GGGTGTACTCTCACAGCCAGTGG + Intronic
1056708747 9:88973003-88973025 GAGACTCCCCCCACCGGCAGGGG - Intergenic
1059826119 9:118030792-118030814 AGGAGTCCCCACATAGGCATGGG - Intergenic
1060297182 9:122350758-122350780 TGGTGGCCACTCACAGGCAGGGG + Intergenic
1061040441 9:128138470-128138492 GGGACCCCCATCACAGGCGGGGG - Intergenic
1061482659 9:130904628-130904650 GGGTTTCCCCTCTCAGGCCGAGG - Intronic
1062012184 9:134273160-134273182 TGGAGGCCCCTGGCAGGCAGTGG - Intergenic
1062024457 9:134333861-134333883 GGGAGTCCCGGCAGAGGCACAGG - Intronic
1062043279 9:134413908-134413930 GGGAGGCTGCTCAGAGGCAGAGG - Intronic
1062044471 9:134418648-134418670 GGCAGTCCCCACCCTGGCAGGGG - Intronic
1062134726 9:134919125-134919147 GGAGGTCCCCTCACACCCAGGGG - Intergenic
1062138458 9:134942319-134942341 GGGAGGCCCCTCTCCAGCAGAGG + Intergenic
1187107097 X:16254464-16254486 GGGATACCCCTCAAAGGAAGTGG - Intergenic
1188738074 X:33742423-33742445 GTGGGTCCCTTCACAGGCGGCGG - Intergenic
1196760686 X:119198178-119198200 TGGAGTCCCCTCAAAGGCAAAGG - Intergenic
1200085707 X:153603592-153603614 GGGACTCCACTCACAGCCACTGG + Intergenic
1200228383 X:154431907-154431929 GAGAGTCCTCTCCCAGCCAGGGG + Intronic
1202373094 Y:24211241-24211263 GGGAGACCACTCAGAGGAAGAGG - Intergenic
1202497688 Y:25458879-25458901 GGGAGACCACTCAGAGGAAGAGG + Intergenic