ID: 1129336323

View in Genome Browser
Species Human (GRCh38)
Location 15:74854238-74854260
Sequence CTGCACTGGGCCTTCCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 325}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129336307_1129336323 29 Left 1129336307 15:74854186-74854208 CCACAGCAGGATGAGTGATGTGC 0: 1
1: 0
2: 2
3: 10
4: 123
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336306_1129336323 30 Left 1129336306 15:74854185-74854207 CCCACAGCAGGATGAGTGATGTG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336316_1129336323 1 Left 1129336316 15:74854214-74854236 CCTGTGAGGGGACTCCCTCGGGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336311_1129336323 7 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336313_1129336323 5 Left 1129336313 15:74854210-74854232 CCTGCCTGTGAGGGGACTCCCTC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325
1129336312_1129336323 6 Left 1129336312 15:74854209-74854231 CCCTGCCTGTGAGGGGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 202
Right 1129336323 15:74854238-74854260 CTGCACTGGGCCTTCCCCTGTGG 0: 1
1: 0
2: 6
3: 38
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129336323 Original CRISPR CTGCACTGGGCCTTCCCCTG TGG Intronic