ID: 1129336328

View in Genome Browser
Species Human (GRCh38)
Location 15:74854261-74854283
Sequence CTTCCCAGCCAACAAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129336312_1129336328 29 Left 1129336312 15:74854209-74854231 CCCTGCCTGTGAGGGGACTCCCT 0: 1
1: 0
2: 0
3: 8
4: 202
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336320_1129336328 10 Left 1129336320 15:74854228-74854250 CCCTCGGGGCCTGCACTGGGCCT 0: 1
1: 0
2: 0
3: 27
4: 299
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336321_1129336328 9 Left 1129336321 15:74854229-74854251 CCTCGGGGCCTGCACTGGGCCTT 0: 1
1: 0
2: 1
3: 27
4: 315
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336316_1129336328 24 Left 1129336316 15:74854214-74854236 CCTGTGAGGGGACTCCCTCGGGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336313_1129336328 28 Left 1129336313 15:74854210-74854232 CCTGCCTGTGAGGGGACTCCCTC 0: 1
1: 0
2: 0
3: 22
4: 145
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336311_1129336328 30 Left 1129336311 15:74854208-74854230 CCCCTGCCTGTGAGGGGACTCCC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336322_1129336328 1 Left 1129336322 15:74854237-74854259 CCTGCACTGGGCCTTCCCCTGTG 0: 1
1: 0
2: 5
3: 43
4: 388
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185
1129336324_1129336328 -10 Left 1129336324 15:74854248-74854270 CCTTCCCCTGTGGCTTCCCAGCC 0: 1
1: 1
2: 6
3: 65
4: 714
Right 1129336328 15:74854261-74854283 CTTCCCAGCCAACAAGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129336328 Original CRISPR CTTCCCAGCCAACAAGCCTC AGG Intronic