ID: 1129336828

View in Genome Browser
Species Human (GRCh38)
Location 15:74857208-74857230
Sequence CTGTCGCAGAGGAGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129336828_1129336834 23 Left 1129336828 15:74857208-74857230 CCTTCCAACCTCCTCTGCGACAG 0: 1
1: 0
2: 3
3: 15
4: 158
Right 1129336834 15:74857254-74857276 GAACACCACCTCTGCCCTGATGG 0: 1
1: 0
2: 5
3: 31
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129336828 Original CRISPR CTGTCGCAGAGGAGGTTGGA AGG (reversed) Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
901909636 1:12445834-12445856 CTTTTGCAGAGGAGGTAGAATGG - Intronic
905319427 1:37105457-37105479 CTGTCCTTGAGGAGGTTCGAGGG + Intergenic
905906042 1:41619111-41619133 CAGGAGCAGAGGAGGCTGGAAGG - Intronic
905923662 1:41735008-41735030 CTGTTGCAGAGCATGTTGGTGGG - Intronic
907934847 1:59032941-59032963 ATGATGCAGAGGAGGATGGAGGG - Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
912435534 1:109658547-109658569 CTGACCCAGAGGAGGGTGGTTGG + Intronic
912950257 1:114115891-114115913 CAGTCCCAGAGGAGGCTGGGTGG - Intronic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
913513194 1:119581070-119581092 GTGGTGCAGAGGAGGATGGAGGG + Intergenic
913516821 1:119612067-119612089 GTGGTGCAGAGGAGGATGGAGGG + Intergenic
920572240 1:207025998-207026020 CTTCCACAGAGGAGGTTGAAGGG + Intronic
922324326 1:224514084-224514106 CTGTTGGAGATGAGGTTTGAAGG - Intronic
1063194656 10:3730129-3730151 GTGTGGCAGAGGAGGTGGCAGGG + Intergenic
1065324748 10:24540800-24540822 CTGTCGCCCGGGAGGCTGGAGGG + Intronic
1067205667 10:44209957-44209979 CTGGAGCAGAGGAGGTAGGCTGG + Intergenic
1069707151 10:70466023-70466045 CTGTCACCGGGGAGGCTGGAGGG + Intergenic
1071445589 10:85743239-85743261 CTTTGGCAGAGGTGATTGGAAGG - Intronic
1072019723 10:91386314-91386336 CTGCCGAAGAGCAGGTTGCATGG + Intergenic
1074778401 10:116783300-116783322 CAGTGGCAGAGGAGCCTGGATGG + Intergenic
1075902489 10:126054401-126054423 ATGTCGCAGAGCAGGTGGGAAGG - Intronic
1077878907 11:6332051-6332073 GTGGCACAGAGGAGGGTGGAAGG - Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1077985685 11:7348931-7348953 CTCACGCTGAGGAGGTTGCAGGG + Intronic
1082647469 11:55746453-55746475 CTGTTACATAGGAGATTGGATGG - Intergenic
1082988476 11:59187341-59187363 CTCTTGCATAGGATGTTGGAAGG + Intronic
1083053531 11:59797954-59797976 CTGTCTCAAAGGATGTTGTAAGG - Intronic
1083803422 11:65059531-65059553 CTGTCCCAGAGGAGGCAGCAGGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085122353 11:73975208-73975230 CTGTCCCAAAGGAGGCTGGGAGG + Intronic
1086110444 11:83193382-83193404 CTTTCTCAGTGGTGGTTGGAAGG - Intergenic
1087275215 11:96154393-96154415 ATGTCTGAGAGGAGGTTGGTAGG - Intronic
1091934480 12:4424159-4424181 AGGTCGCAGAGGAGGTTGGAGGG - Intergenic
1093478320 12:19579356-19579378 CAGTCGCAGAGGGGGTGAGAGGG - Intronic
1093533912 12:20201142-20201164 CTGTCTCCTATGAGGTTGGAAGG + Intergenic
1093937767 12:25019469-25019491 CTGTCAGAGAGGAGTTTGGCTGG - Intergenic
1097323016 12:58246463-58246485 CTGACCCAGAGGAGACTGGAAGG + Intergenic
1099332528 12:81307662-81307684 AGGTCTCAGTGGAGGTTGGAAGG - Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1106342385 13:28842907-28842929 CTGTCCCAGAGGGGGTTCTAAGG - Intronic
1108746542 13:53401036-53401058 CTGGCCCAGAGCAGGTCGGATGG - Intergenic
1110275134 13:73634254-73634276 GTGTCCCAGAGGAAGTTGGGAGG + Intergenic
1112322758 13:98422207-98422229 CCGTAGCAGATGAGCTTGGAGGG + Intronic
1112953515 13:105031716-105031738 CTGAAGCAGAGGAAGTTAGATGG + Intergenic
1113786761 13:113006164-113006186 CTCTCGCAGAGGGGCTGGGAGGG - Intronic
1115431965 14:33329612-33329634 TAGTCTCAGAGGAGGTTGGTGGG + Intronic
1115857763 14:37649447-37649469 CTGGCCCAGAGGAAGTTGGCAGG - Intronic
1116048986 14:39780909-39780931 CTGTTGCAGTGGAGGTGGCAGGG + Intergenic
1116317634 14:43417811-43417833 CTGTTGGGGAGGAGGTTGGTTGG + Intergenic
1117716501 14:58586967-58586989 CTATGGCAGGGGAGTTTGGAGGG - Intergenic
1122011625 14:98753891-98753913 CTGTCCCAGAGGACCCTGGAGGG - Intergenic
1122445418 14:101763870-101763892 CAGTAGCAGAGGTGGTTTGAAGG - Intronic
1128922313 15:71622993-71623015 CTGTTGCAGTGCTGGTTGGATGG + Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1139731867 16:68952737-68952759 CTGCCCCAGAGGAGGATTGAAGG + Intronic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1141982282 16:87557911-87557933 CTCTAGCAGAGGAGATGGGAAGG + Intergenic
1143265308 17:5632447-5632469 CTGTAGCAAAGCAGATTGGAAGG + Intergenic
1143790580 17:9292141-9292163 CTGGCCCAGAGGTGGATGGACGG + Intronic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1145985897 17:29045983-29046005 GAGTCACAGAGGAGGTGGGAGGG - Intronic
1147868546 17:43570865-43570887 CTCTGGCATAGGAGGTGGGATGG - Intronic
1147930446 17:43977299-43977321 CTATCAGAGAGGAGGGTGGAAGG + Intronic
1148090536 17:45020326-45020348 CTGAGGCAGAGGAGCTAGGAAGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149419399 17:56494468-56494490 TGGTCCCAGAGGAGGTTGGGAGG + Intronic
1151396458 17:73826374-73826396 CTGTCCCTGAGCAGGGTGGATGG + Intergenic
1152682782 17:81677832-81677854 CTGACCCAGAGGAGACTGGAAGG + Intergenic
1153954096 18:10081348-10081370 CTCTGGCACAGGAGGCTGGAGGG + Intergenic
1155256731 18:24004352-24004374 TTGTCTCAGAGGAGGTGGTAGGG + Intronic
1160042637 18:75359763-75359785 CTGTGGGAGACAAGGTTGGAAGG + Intergenic
1160870805 19:1276946-1276968 CTGGCGCAGGGGAGATGGGAGGG + Intronic
1163254048 19:16144148-16144170 CTGGCACAGAGGAGGGTGCAAGG - Intronic
1166517310 19:43457070-43457092 CTGTCTGGAAGGAGGTTGGAGGG + Intergenic
1168322468 19:55518296-55518318 CTGTCCCCAAGGAGGTTGGAAGG - Exonic
925629963 2:5882061-5882083 CTTTTGCAGAGGAAGTTGCAGGG - Intergenic
926707770 2:15848785-15848807 TTGTCCCAGACGAGGTTGGAAGG + Intergenic
927893981 2:26769680-26769702 CTGAGGCAGAGGTGGCTGGAGGG - Intronic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
930127685 2:47815509-47815531 CTGACCCAGAGGAGACTGGAAGG - Intronic
930741736 2:54838601-54838623 CTGTAGCAGAGGGAATTGGAAGG + Intronic
931078498 2:58742899-58742921 CTACTGCAGAGGAGGGTGGAGGG + Intergenic
931712727 2:65003092-65003114 CTGTCACAGAGGAGGCGGGTGGG + Intronic
932236617 2:70125481-70125503 GTGTATCAGAGGAGGTTGGGGGG - Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933856384 2:86418398-86418420 CTGTCGGGCAGGAGATTGGAGGG - Intergenic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
941906226 2:170717425-170717447 CTCTCGCAGAGGTGCTGGGAAGG - Exonic
942422175 2:175819726-175819748 CTGTCGCAGGTGAGGTGGCAGGG - Intergenic
942656366 2:178218200-178218222 CTTTTGAAAAGGAGGTTGGAAGG + Intronic
942915490 2:181300849-181300871 GTGTAGCAAAGGATGTTGGAAGG + Intergenic
943082042 2:183267237-183267259 CTGACCCAGAGGAGACTGGAAGG - Intergenic
943909371 2:193542993-193543015 CTGCTCCAGAGGAGGTGGGAAGG - Intergenic
945932299 2:215867084-215867106 CTGTGGCAGAAGAGGTGAGAGGG - Intergenic
946399662 2:219461686-219461708 CAGTGGCAGAGGAGGTTCCAGGG + Intronic
946507766 2:220319560-220319582 CTGTGGGAGAGGAGTTTGCAAGG - Intergenic
946881901 2:224185012-224185034 GTGAGGCAGAGGAGGGTGGATGG - Intergenic
947908074 2:233780203-233780225 CTGGGGTAGAGGATGTTGGAGGG + Intronic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1171488541 20:25500767-25500789 CTGCTGCAGAGGAGGATGGATGG - Intronic
1173860436 20:46279665-46279687 CTGGCGCTGAGGAAGTGGGAGGG + Intronic
1175681774 20:60994643-60994665 CTGAGGTAGAGGAGGTGGGAGGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177078265 21:16605924-16605946 GTGTGCCAGAGGAGCTTGGAAGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179991094 21:44948601-44948623 CTGGAGCAGAGGATGTTGGGAGG + Intronic
1182287258 22:29255732-29255754 CTGGCCCAGAGGAGGTTGGAGGG + Intronic
1182990598 22:34763818-34763840 CTCTCACAAAGGAGCTTGGATGG - Intergenic
1183212022 22:36457121-36457143 CGGGTGCAGGGGAGGTTGGAAGG - Intergenic
1184347213 22:43921352-43921374 CTGTCCCACTGGAGGCTGGATGG + Intergenic
1185409211 22:50673848-50673870 CTCTCGCCGAGGCGGTGGGAAGG + Intergenic
949394687 3:3602385-3602407 TGGTAGCAGAGGAGGTTGGTGGG + Intergenic
949891727 3:8738266-8738288 CTGTGGCAGATGTGGGTGGAGGG - Intronic
955514505 3:59713439-59713461 CTCTCTCAGTGAAGGTTGGAGGG + Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960548231 3:118942861-118942883 GTGGGGCAGAGGAGGTAGGAGGG + Intronic
963907076 3:150781606-150781628 CTAACCCAGAGGAGATTGGATGG + Intergenic
966724742 3:183099340-183099362 CTGCCGCCGAGGTGGGTGGAGGG - Exonic
970381039 4:15508099-15508121 CTGTCCCCCAGGTGGTTGGAGGG - Intronic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
977638230 4:99325264-99325286 CTATCACAGAGAAGGCTGGATGG - Intergenic
978402400 4:108344493-108344515 CTTTCCCAGAGGAGTTTGAAGGG - Intergenic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
979919303 4:126478468-126478490 CTGTCAGAGAGGAGTTTGGCTGG + Intergenic
981097092 4:140793099-140793121 CTGTTGCAGAGGGGGCTGTAAGG - Intergenic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
983791984 4:171810656-171810678 CTGAGGCCGAGGAGGTTGAATGG - Intergenic
983884277 4:172963068-172963090 GAGTCAGAGAGGAGGTTGGAGGG - Intronic
984943325 4:184952675-184952697 CTGTCACAGAGGAGGAGGGGAGG + Intergenic
989035669 5:37169205-37169227 CTGTGGCAGAGCAGGTTGGAAGG + Exonic
995689491 5:114808377-114808399 CTGTCACAGAGGAGTTATGAAGG - Intergenic
996800633 5:127398805-127398827 CAGGGGCAGAGGAGGTGGGAAGG - Intronic
998208493 5:140175948-140175970 CGGTAGCAGTGGAGGTTGCAGGG + Intronic
1007215458 6:40234238-40234260 CTGTCGCAGAGCAAAATGGAAGG + Intergenic
1008047820 6:46869425-46869447 GTGTTACAGAGGAGGTTGGAGGG - Intronic
1008646567 6:53520474-53520496 CTGCCGCAGGCGAGGGTGGAGGG - Intronic
1010011784 6:71056134-71056156 CTGTGGCAGAGCAGGTTCTAAGG - Intergenic
1015958247 6:138620837-138620859 CTGGCTCAGAGGATGTGGGAGGG - Intronic
1017962173 6:159232541-159232563 CTGTCGCGGAGAACGCTGGACGG - Exonic
1018218256 6:161551870-161551892 CTGTCCTTGAGTAGGTTGGAGGG + Intronic
1023791495 7:43757319-43757341 CAGTAGCAGATGAGGTTGTAGGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1026657189 7:72267128-72267150 CTTTCTAAGAGGAGGTTTGAAGG - Intronic
1026831231 7:73611411-73611433 TTGTCCCAGAGGAAGTTGGCTGG - Intronic
1031921112 7:127601240-127601262 ATGTCGGAGATGAGATTGGATGG - Intronic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033870817 7:145751677-145751699 CTGTCTCAGGGAAGGTTGCAAGG - Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1035678634 8:1471542-1471564 GCGTCGCAGAGGAGGTTAGGAGG - Intergenic
1035824419 8:2629195-2629217 CAGTCACAGAGGAGTTTGGCTGG - Intergenic
1040277442 8:46021213-46021235 CTGGCGCAGAGGTGCTGGGAAGG + Intergenic
1042837006 8:73088018-73088040 CTTTCTTAGAGGAGGTGGGAAGG + Intronic
1046006133 8:108488060-108488082 CTGACGGGGAGGAGGTTTGAAGG - Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047969754 8:130074628-130074650 CTGTCCCCGAGGGGGTGGGAGGG + Intronic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1060349237 9:122843118-122843140 AGGTCGCAGAGGAGGTAGGTAGG - Intergenic
1061970992 9:134045408-134045430 GTGTTGCAGAGGAAGATGGATGG - Exonic
1188526573 X:31094166-31094188 CTGTCAGAGAGGAGTTTGGCTGG - Intergenic
1197792636 X:130270786-130270808 CAGAGGCAGAGGAAGTTGGATGG - Intergenic
1197897457 X:131330550-131330572 GAGTCTCTGAGGAGGTTGGAGGG + Intronic
1197968821 X:132093771-132093793 CTTTCCCAGAGGCGGTAGGAGGG + Intronic
1200067136 X:153509332-153509354 CTGTCCCGGAGGAGGTTGGGAGG + Exonic