ID: 1129342773

View in Genome Browser
Species Human (GRCh38)
Location 15:74897082-74897104
Sequence CTGAGCATTTCACACAGGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342773_1129342776 0 Left 1129342773 15:74897082-74897104 CCAACCCTGTGTGAAATGCTCAG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1129342776 15:74897105-74897127 CTATACCCCTAGCTCCAGCAAGG 0: 1
1: 0
2: 1
3: 5
4: 118
1129342773_1129342782 23 Left 1129342773 15:74897082-74897104 CCAACCCTGTGTGAAATGCTCAG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1129342782 15:74897128-74897150 ACAGGCTCTTTCTCCCAACACGG 0: 1
1: 0
2: 1
3: 11
4: 202
1129342773_1129342778 5 Left 1129342773 15:74897082-74897104 CCAACCCTGTGTGAAATGCTCAG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1129342778 15:74897110-74897132 CCCCTAGCTCCAGCAAGGACAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1129342773_1129342783 30 Left 1129342773 15:74897082-74897104 CCAACCCTGTGTGAAATGCTCAG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342773 Original CRISPR CTGAGCATTTCACACAGGGT TGG (reversed) Exonic
900537490 1:3186062-3186084 CTGAGCTGTACACACTGGGTGGG + Intronic
904055694 1:27668591-27668613 CTGAGCATCAGACACAGAGTAGG - Intronic
904413622 1:30341483-30341505 CTGCCCATTTCAGATAGGGTTGG - Intergenic
905506278 1:38482091-38482113 CAGGGTATTTCACACAGAGTAGG - Intergenic
909514578 1:76492690-76492712 CTCAGTATTTCCCTCAGGGTGGG - Intronic
912344114 1:108948249-108948271 CTGAGCATTCCATACAGCATGGG - Intronic
912517249 1:110224111-110224133 GTGAGTATTCCACCCAGGGTAGG + Intronic
915014415 1:152719776-152719798 CTGGGCACTTCACATAGGTTTGG - Exonic
915697907 1:157762917-157762939 TTGAGCATTTCTTACAGGGCTGG - Intronic
915904526 1:159868081-159868103 CTGAGCATTTCAGGGAGGGGAGG - Intronic
916168387 1:161982895-161982917 CTGATCACTTCACCCAAGGTTGG - Intergenic
916679310 1:167089655-167089677 CTGAGCATTTCCCTCTGGGAGGG - Intronic
917499612 1:175574274-175574296 CTTTTCATTTCACCCAGGGTGGG - Intronic
919790895 1:201290323-201290345 CTGAGGATGGCACACAGGTTGGG + Intronic
920527522 1:206678562-206678584 CTGAGCCATGCACACAGGCTGGG + Intronic
921211333 1:212901674-212901696 CTTAGCATTTCTCGCAAGGTAGG - Intergenic
923279364 1:232427834-232427856 CTGGGCATTTTAAACAGGGTTGG - Intronic
1063004852 10:1960243-1960265 TTCAGCATTTCTCACAGGGCTGG + Intergenic
1064086696 10:12350487-12350509 CTGTGCATTTCACGCGGGCTCGG + Intronic
1071363314 10:84873378-84873400 CTGAGCATTTCTTACAGAATGGG + Intergenic
1072607233 10:96994949-96994971 CTGTGCTTTTCATACAGGTTGGG - Intergenic
1074408689 10:113203646-113203668 TTTAGCATTTCTTACAGGGTGGG - Intergenic
1075026293 10:118986280-118986302 TTGAGCATTTCTTGCAGGGTAGG - Intergenic
1075955065 10:126516556-126516578 CTGAGCATTGCACTAAGGGCTGG - Intronic
1077181375 11:1218731-1218753 CTGAGACCTTCACACAGGGCAGG + Intergenic
1078781712 11:14444936-14444958 CTGAGCACTTAACACACGTTAGG - Intronic
1079051161 11:17160973-17160995 GTGAGCAGTTCACACATGGATGG + Intronic
1081484753 11:43518934-43518956 CTGAGCATTGCACAAAGGCAAGG - Intergenic
1082202338 11:49387336-49387358 CTGAGCATCTCACACTTGGATGG - Intergenic
1083527417 11:63382210-63382232 TGGAGCATTTCACACAGAGAAGG - Exonic
1083768221 11:64852476-64852498 CTGAGCAGTTCACTTGGGGTGGG - Exonic
1084136446 11:67186486-67186508 CTGAGCATTTCTTACAAGGCAGG - Intronic
1085106555 11:73848733-73848755 CTCAGTATTTCACACAGTATAGG + Intronic
1085294109 11:75421071-75421093 CTGAGCGTTCCCCATAGGGTGGG + Intronic
1088260886 11:107943038-107943060 CTGAGTATTGCACAGAGGGGAGG - Intronic
1089768968 11:120788947-120788969 CTGAGCATTCTCCACAGGGCTGG - Intronic
1090070974 11:123544664-123544686 CTGAGCATTGCCCACAGCGGCGG + Intronic
1091713575 12:2760261-2760283 CTGAGCATCTCAGGCAGGGTAGG - Intergenic
1092154943 12:6276078-6276100 CTGAGCTTTTCACCTGGGGTTGG - Intergenic
1093310476 12:17576153-17576175 CTGAGCATATCACAAGGAGTGGG + Intergenic
1098134897 12:67391815-67391837 AAGAGCATTTCAGACAGAGTAGG + Intergenic
1098591522 12:72219546-72219568 CTGAGCATGTGACCCAGGATGGG - Intronic
1099532284 12:83799120-83799142 CTGAGCATTTTTCACATGCTAGG - Intergenic
1101219360 12:102620857-102620879 CTGAGCAAATCACCCAGAGTTGG - Intergenic
1101399880 12:104378121-104378143 CTGAGCTTCTAGCACAGGGTAGG - Intergenic
1107203176 13:37747383-37747405 CAGTGCAATTCACTCAGGGTTGG - Intronic
1108110127 13:47062491-47062513 TTGAGCATTTCTTGCAGGGTAGG + Intergenic
1108314964 13:49227899-49227921 AAGAGCGTTTCACAGAGGGTCGG + Intergenic
1109708294 13:66129076-66129098 GTGTGAATTTCACACAGGCTAGG + Intergenic
1110174747 13:72542487-72542509 CTGAGCAATTAACACATGCTGGG + Intergenic
1110425115 13:75358165-75358187 ATGAGCACTTTACACATGGTGGG - Intronic
1111761186 13:92467221-92467243 CGGAGCTTTTCAGACAGTGTTGG + Intronic
1113001909 13:105648999-105649021 CTGAGCATTTCTTGCAGGGAAGG - Intergenic
1113520562 13:110937635-110937657 CTGAGCATTCCTCACAGGGAAGG - Intergenic
1116364039 14:44038573-44038595 CAGATCATTGCACACAGGCTGGG + Intergenic
1122816384 14:104316182-104316204 CTGGGCATCGCACACAGGGTTGG - Intergenic
1129342773 15:74897082-74897104 CTGAGCATTTCACACAGGGTTGG - Exonic
1132077160 15:98831421-98831443 GTGAAGATGTCACACAGGGTGGG - Intronic
1135142807 16:19936044-19936066 ATGAGCATCTGTCACAGGGTCGG - Intergenic
1135902776 16:26479650-26479672 TTGAGCATTTCTTGCAGGGTAGG - Intergenic
1137444775 16:48525029-48525051 GTGAGCATCTCACAGAGGGAGGG - Intergenic
1137692239 16:50437013-50437035 CTGAAAAATGCACACAGGGTGGG - Intergenic
1137866283 16:51900055-51900077 CTGAGACTTTCATACAGGTTTGG + Intergenic
1138580543 16:57938136-57938158 CTCAGCATTTCTCAGAGTGTGGG + Intronic
1147763697 17:42818608-42818630 CTGTGCATTCCTCACAGAGTGGG + Exonic
1150654066 17:67028173-67028195 CTAACCCTTCCACACAGGGTGGG + Intronic
1152026945 17:77816001-77816023 CTGAGCATTTCTCATAGAATTGG - Intergenic
1152216634 17:79036802-79036824 CTGACCATCTAACACAGGCTGGG - Intronic
1153134642 18:1901094-1901116 ATGAGGGTTTCACACATGGTAGG + Intergenic
1154413006 18:14151641-14151663 GTGAGGATTCCACACAGGATGGG + Intergenic
1154955918 18:21254502-21254524 CTTAGCGTTTCCCAAAGGGTGGG + Intronic
1155228942 18:23755356-23755378 CTGAGCCTTTCACCAAGGCTTGG - Intronic
1157640763 18:49211674-49211696 CTGGGCATTGAAGACAGGGTGGG + Intronic
1158430797 18:57385564-57385586 CTGAGCCTTTCACACAGTCCTGG - Intergenic
1161731659 19:5964540-5964562 CTGAACATATGACACAGGGGAGG + Intronic
1163954068 19:20618016-20618038 CTGAGCATTGAACACAGAGTGGG - Intronic
1164735088 19:30535442-30535464 CTGGGCATGTAACACAGGCTGGG - Intronic
1164802535 19:31089493-31089515 ATGAGGATGTGACACAGGGTCGG + Intergenic
1165891529 19:39115471-39115493 CTGTGCACGTCACACAGGGCAGG - Intergenic
1165979523 19:39708036-39708058 GTGAGCAAATCACACAAGGTCGG - Intronic
1168145541 19:54418588-54418610 CTGAGCTTGTCACCCAGGGACGG - Intronic
925638614 2:5966253-5966275 CTAAGCATTTCTTGCAGGGTTGG + Intergenic
926216770 2:10910777-10910799 ATCAACATCTCACACAGGGTGGG + Intergenic
926759971 2:16269972-16269994 CAGAGCTTTTCACACATGGTAGG - Intergenic
927298140 2:21478431-21478453 ATGAAAATTTCACACATGGTAGG - Intergenic
928811072 2:35227023-35227045 CTGAGCAGTTCACAAATGTTTGG - Intergenic
929678012 2:43957167-43957189 CTGAGAAATGCACACAGGTTTGG - Intronic
931258480 2:60596256-60596278 ATGATCATATCACACAGGCTTGG + Intergenic
932467488 2:71933052-71933074 CTGAGCACAGCACACAGGGCTGG + Intergenic
933693602 2:85198466-85198488 CTGAGCATTTTCCACAGGCAGGG + Intronic
937512863 2:122617313-122617335 TTTAACATTTCACATAGGGTTGG + Intergenic
938369678 2:130761409-130761431 GTGAGCATGGGACACAGGGTGGG - Intronic
943361767 2:186927981-186928003 CTCAGCATTTCTCTCATGGTAGG - Intergenic
943965797 2:194330119-194330141 CTGGAAATCTCACACAGGGTTGG + Intergenic
945420098 2:209624873-209624895 CTGAGCATTTATCACTGGCTGGG - Intronic
945974077 2:216257477-216257499 CTGGTCATTTCACAGAGGCTGGG - Intergenic
1170711700 20:18797235-18797257 CTGAGCATTTAACACATGGCTGG - Intergenic
1170916922 20:20635264-20635286 CTTGGCATTACAGACAGGGTAGG + Intronic
1176296042 21:5073686-5073708 GTGAGCATCTCACCCAGGCTGGG + Intergenic
1176408231 21:6433487-6433509 CTCAGCAGTCCACACAGGGTGGG - Intergenic
1179552835 21:42154380-42154402 ATGAGAAAGTCACACAGGGTGGG + Intergenic
1179553109 21:42155769-42155791 ATGAGAAAGTCACACAGGGTGGG - Intergenic
1179683722 21:43041813-43041835 CTCAGCAGTCCACACAGGGTGGG - Intergenic
1179785481 21:43727620-43727642 CTGTGCAGTGCACACAGGTTTGG + Intronic
1179861007 21:44188435-44188457 GTGAGCATCTCACCCAGGCTGGG - Intergenic
1180715340 22:17868128-17868150 CTGAGCAGTTGAGACAGTGTTGG - Intronic
1181633850 22:24165270-24165292 CTGAGCACAGCACACAGGGTGGG + Intronic
1184754538 22:46508502-46508524 CTGAGCATTTCTCACAGCCGGGG + Intronic
950548346 3:13652287-13652309 CTGAGCACCCCACACAGAGTTGG + Intergenic
950658591 3:14452646-14452668 CTTAGCACTGCACACAGGGTGGG - Intronic
951346223 3:21549425-21549447 CTGAGAATTCCTCACAGAGTTGG + Intronic
951396470 3:22173779-22173801 CTGAGCTTTTCACAGAGGGCTGG - Intronic
952374274 3:32752432-32752454 CTTAGCATTTTACACATGGACGG - Intronic
954004673 3:47581217-47581239 CTGAGCATAGCACACTTGGTTGG + Intergenic
959159004 3:102701252-102701274 CTGGTCATTTCACCCAAGGTAGG + Intergenic
960708542 3:120504775-120504797 CTGAGCATTTGTCACAGTGAAGG - Intergenic
961466184 3:127083045-127083067 CTGAGCATGTGACACAGGCCTGG - Intergenic
967751132 3:193117722-193117744 ATGAGAATATGACACAGGGTTGG + Intergenic
971077778 4:23169792-23169814 CTGAGGGCTTCACACAGGCTGGG + Intergenic
971183998 4:24356245-24356267 CTGTGCAATTCACACATGCTTGG - Intergenic
971309753 4:25515109-25515131 CTGAGCAGTTCAAACTTGGTGGG + Intergenic
971914773 4:32853657-32853679 CTTATCATTTCTCACAGTGTAGG - Intergenic
972994513 4:44863807-44863829 CTTAGTATTTCACACAGTGGTGG + Intergenic
973529144 4:51818087-51818109 CTGAGCAGTTCACTTAGGGACGG + Intergenic
976368643 4:84260719-84260741 TTGAGCATTTCTTATAGGGTTGG - Intergenic
983520202 4:168700608-168700630 CTTAGCATCTCACACATGGTAGG - Intronic
985012630 4:185599943-185599965 CTCAGCGGTTCCCACAGGGTAGG - Intronic
990292970 5:54373495-54373517 TTGAGCATTTCTCACAGGGCAGG + Intergenic
1002211399 5:177601576-177601598 CTGTGCTTTTGACACAGGGTTGG + Intronic
1005563783 6:27068478-27068500 GTGAGCATATCAGTCAGGGTGGG - Intergenic
1010359294 6:74974053-74974075 CTGTGCTTTTCACAAAGGGATGG + Intergenic
1010456866 6:76066049-76066071 TTGAGCATTTCTCATAGGGGTGG - Intronic
1011697232 6:89923336-89923358 CTTAGCATGTAACACAGTGTTGG + Intergenic
1011774776 6:90717445-90717467 CTGAGCATTCAAGACAGTGTTGG - Intergenic
1011783713 6:90819688-90819710 CTAATCATTTCACTCAGGTTGGG + Intergenic
1013450829 6:110279160-110279182 CTGTGCATTTCACATGGGCTAGG + Intronic
1018062991 6:160104903-160104925 CTGTGCGTTTCTCACTGGGTGGG - Exonic
1018254391 6:161904002-161904024 CTGGCCTCTTCACACAGGGTTGG + Intronic
1019049389 6:169171356-169171378 CTCAGCATTTCCCACATGGAAGG - Intergenic
1019080127 6:169424721-169424743 CTCAGCAGTTCACACAGGACGGG - Intergenic
1024293558 7:47825051-47825073 TAGAGCATTTCACACAGTGCTGG - Intronic
1024556357 7:50606248-50606270 CGCCTCATTTCACACAGGGTGGG - Intronic
1024692596 7:51819096-51819118 CTGACCAGTGCACACAGGGATGG + Intergenic
1028768791 7:94591273-94591295 ATGGGCATCTCACACAGGGTGGG + Intronic
1029136742 7:98378336-98378358 CTGTCCTTTTAACACAGGGTGGG + Intronic
1029339687 7:99932966-99932988 CGTGGAATTTCACACAGGGTGGG + Intergenic
1029497006 7:100901138-100901160 CTGAGTATTTAACACAAGATTGG + Intergenic
1029673644 7:102051005-102051027 CTGAGGATGTCAATCAGGGTGGG - Intronic
1032451758 7:132037368-132037390 CTCAGGATGTCTCACAGGGTGGG + Intergenic
1032533915 7:132644899-132644921 CTGAGCTGGGCACACAGGGTTGG - Intronic
1033932178 7:146537709-146537731 GTGAGCATTTCAGGCAGAGTTGG + Intronic
1035671569 8:1422038-1422060 CTGAGCATCTAACACACGCTAGG + Intergenic
1036609016 8:10333864-10333886 ATGAGCACTTCACACAAGGCAGG + Intronic
1039739755 8:40371813-40371835 ATGAGAATTTTACACAGGATTGG + Intergenic
1039777541 8:40751890-40751912 CTCAGCATTTTGCACAGGGGGGG - Intronic
1042351242 8:67779854-67779876 ATCAGCATTTCATATAGGGTTGG + Intergenic
1042556142 8:70035075-70035097 CTGAGGCTTTCACAGAGGGCGGG + Intergenic
1042661108 8:71155499-71155521 CTTAGCATTTCACAACTGGTGGG + Intergenic
1042865469 8:73353232-73353254 CAGAGCAGGTCAGACAGGGTGGG + Intergenic
1044858324 8:96497506-96497528 GTGATCATATTACACAGGGTAGG - Intronic
1046749031 8:117907358-117907380 CAGAGCCTTGCACAAAGGGTTGG + Intronic
1046788653 8:118295957-118295979 CTAAGCAGTTCACACTGGGATGG + Intronic
1048425390 8:134318826-134318848 CTGAGCAGTTGAGACTGGGTTGG - Intergenic
1050958015 9:11689017-11689039 CTGACCAATTTACCCAGGGTAGG - Intergenic
1055851415 9:80635046-80635068 CTGAACATTTCTTACAGGGCAGG + Intergenic
1056383004 9:86072426-86072448 CTTAGAATGTCACCCAGGGTGGG - Intronic
1057702698 9:97375371-97375393 CTAAGCTTTTCCAACAGGGTTGG + Intronic
1058482288 9:105408243-105408265 CTTAGCATTTCTCATAGGGCAGG - Intronic
1061317748 9:129807517-129807539 CTCAGCATGGCACACAGTGTGGG + Intronic
1061397693 9:130352565-130352587 ATGAGGACTTCACACAGGGCTGG - Intronic
1187939516 X:24368183-24368205 TTGAGCCTTTGTCACAGGGTGGG + Intergenic
1189360996 X:40351164-40351186 TTTAGCATTTCTCATAGGGTAGG + Intergenic
1189474875 X:41343974-41343996 ATGAACTTTTCAAACAGGGTAGG + Intronic
1190111222 X:47590329-47590351 GTGAGGAGTCCACACAGGGTGGG - Intronic
1193436879 X:81484821-81484843 TTGAGCATTTCTTACAGGGCTGG - Intergenic
1195034542 X:100960460-100960482 TTTAGCATTTCTCACAGGGCAGG - Intergenic
1195662811 X:107397749-107397771 CTGAACATTTCAAATAGGTTTGG - Intergenic
1196201759 X:112894175-112894197 CTGAGGGTTTCACAAAGGGATGG + Intergenic
1196635564 X:117998669-117998691 TTGAGCATGTCACAAAGGGTGGG - Intronic
1198568315 X:137928597-137928619 CTTAGAATTTCACAAAGAGTTGG + Intergenic
1198770322 X:140123985-140124007 TTGAGCATTTCTCACAGGACAGG + Intergenic