ID: 1129342775

View in Genome Browser
Species Human (GRCh38)
Location 15:74897087-74897109
Sequence TATAGCTGAGCATTTCACAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342775_1129342778 0 Left 1129342775 15:74897087-74897109 CCTGTGTGAAATGCTCAGCTATA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1129342778 15:74897110-74897132 CCCCTAGCTCCAGCAAGGACAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1129342775_1129342783 25 Left 1129342775 15:74897087-74897109 CCTGTGTGAAATGCTCAGCTATA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342775_1129342776 -5 Left 1129342775 15:74897087-74897109 CCTGTGTGAAATGCTCAGCTATA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1129342776 15:74897105-74897127 CTATACCCCTAGCTCCAGCAAGG 0: 1
1: 0
2: 1
3: 5
4: 118
1129342775_1129342782 18 Left 1129342775 15:74897087-74897109 CCTGTGTGAAATGCTCAGCTATA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1129342782 15:74897128-74897150 ACAGGCTCTTTCTCCCAACACGG 0: 1
1: 0
2: 1
3: 11
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342775 Original CRISPR TATAGCTGAGCATTTCACAC AGG (reversed) Exonic
902322693 1:15679779-15679801 TATAGCTGTGCGTGTCACAAAGG + Intergenic
904391936 1:30191699-30191721 AGGAGCTGAGCACTTCACACAGG + Intergenic
915142023 1:153773759-153773781 CATAGATGCCCATTTCACACTGG - Exonic
917069404 1:171133713-171133735 AATAGCTTATCATTTCACAATGG + Intergenic
917944385 1:179954483-179954505 TTTGGCTGCGCATTTCACCCCGG - Intergenic
920964322 1:210689646-210689668 TACTGCTGAGCATTTCAGACTGG - Intronic
921897978 1:220420982-220421004 TTTAGCTGAGCAATTCAGAAAGG + Intergenic
922489371 1:226003471-226003493 TATAGCCAAGCATTTCAAAGAGG + Intergenic
923899835 1:238313690-238313712 TATAGTAGAGCATTTCATAAAGG + Intergenic
924243974 1:242063687-242063709 TTTAGCAGAGCAGTACACACAGG - Intergenic
1063589835 10:7385359-7385381 GAGAGCTGAGCATTCCACAGTGG - Intronic
1068787936 10:60997601-60997623 CAGGGCTGAGCATTTAACACTGG - Intronic
1078696389 11:13636584-13636606 AGTAGCTGACCATGTCACACTGG + Intergenic
1080948739 11:37004413-37004435 AATAGGTGACCATCTCACACAGG - Intergenic
1081722394 11:45299858-45299880 TAAAGCTGAGCATCTCAAACAGG - Intergenic
1089182368 11:116591850-116591872 TCCAGCTGAAAATTTCACACAGG + Intergenic
1093442919 12:19220693-19220715 TCTAGGTCTGCATTTCACACAGG - Intronic
1094640001 12:32264832-32264854 TATAGTGAAGAATTTCACACTGG - Intronic
1094748829 12:33381052-33381074 TACAACTGAGCATTTGTCACTGG - Intronic
1095127369 12:38497150-38497172 TACAGCTGATCTTTTCACTCAGG + Intergenic
1095153602 12:38825100-38825122 AATAGCCGAGAAATTCACACTGG - Intronic
1095589363 12:43886807-43886829 TAGAGCGGAACAATTCACACTGG - Intronic
1098449738 12:70606688-70606710 TATAGCTCAGCAATTAACATAGG + Intronic
1098918791 12:76284092-76284114 TACAGCTGTGCATTTCACCATGG + Intergenic
1101570959 12:105953333-105953355 TAAAGCTGAGCATTGCAAAGTGG + Intergenic
1102823925 12:115930790-115930812 TGTAGCTGATCTTTTCACATTGG + Intergenic
1105894631 13:24707558-24707580 TGTAGCTCTGCATTTCTCACAGG + Intronic
1108736359 13:53287580-53287602 GATAGCTGAGAATCTCACAATGG - Intergenic
1112376810 13:98850259-98850281 TATAGCTGACCACTCTACACTGG + Intronic
1112681855 13:101776092-101776114 TATAGATGAACATTACACATAGG + Intronic
1113537687 13:111081410-111081432 TTAAGATGACCATTTCACACAGG - Intergenic
1120185518 14:81389892-81389914 TACAGCTGAGAATTTGAAACTGG - Intronic
1125283064 15:38063721-38063743 TACAGCTGAGCATTTCTTAAAGG - Intergenic
1126696436 15:51329876-51329898 TATATCTGGTCATTTCACAATGG - Intronic
1129342775 15:74897087-74897109 TATAGCTGAGCATTTCACACAGG - Exonic
1130685655 15:86034783-86034805 TATAGGTTTGCATTTTACACTGG + Intergenic
1134312227 16:13085452-13085474 TGCAGCTGTACATTTCACACTGG - Intronic
1138851943 16:60640244-60640266 TATAGCCTAGCATTTCACAAGGG - Intergenic
1141120458 16:81350962-81350984 TAGAGGTGTGCATATCACACTGG - Intronic
1144050078 17:11490800-11490822 TATAGATGAGCATTCCTCCCTGG - Intronic
1147184821 17:38707390-38707412 TAGAGCTTAGCATTTCAGCCTGG + Intronic
1149980548 17:61307836-61307858 TTTTGCTGTGCATTTGACACAGG - Intronic
1157430449 18:47620112-47620134 TATGGCCAAGCATTTCTCACTGG - Intergenic
1158742570 18:60160308-60160330 TATAGCTCAGCAGCTCCCACTGG - Intergenic
1159841875 18:73407586-73407608 GCTAGCTCATCATTTCACACTGG - Intergenic
1160076188 18:75679903-75679925 TTCTGGTGAGCATTTCACACTGG + Intergenic
1161092406 19:2368368-2368390 TATAGCTGAGGATGTCAGGCAGG + Intergenic
1161807475 19:6453195-6453217 TACAGATGAGCATTTCAGGCTGG - Intronic
1162250853 19:9442406-9442428 TATCTCAGAGCATTTCACAGAGG - Intergenic
926906667 2:17812045-17812067 GACAACTGGGCATTTCACACTGG - Intergenic
931773160 2:65517023-65517045 CATAACTGAACATTTCACCCTGG + Intergenic
931875405 2:66506614-66506636 TATATCTGATCATATCACCCTGG - Intronic
932510619 2:72284887-72284909 TATACCTAAGCATTTCATTCTGG - Intronic
934039495 2:88116191-88116213 TACAGCTTAGCATTTGACATCGG - Intergenic
934215571 2:90028454-90028476 TGTATCTGAGACTTTCACACTGG + Intergenic
935219984 2:101003880-101003902 AATTGCTGGGCATTGCACACTGG + Intronic
941084667 2:161103438-161103460 TAACACTGAGTATTTCACACAGG + Intergenic
945013442 2:205489097-205489119 TATAGTTGAAAAGTTCACACTGG - Intronic
1169023708 20:2349572-2349594 TATGGGTGAGCATTTCCGACAGG - Intergenic
1170264904 20:14455055-14455077 TCTTGCTGTGCATTTCACATTGG + Intronic
1175144048 20:56882506-56882528 GATAGCTGAGCATTACAGATTGG - Intergenic
1175240456 20:57543990-57544012 TATAAATGAGCATTTCTCAGTGG - Intergenic
1183413410 22:37668696-37668718 TATGGCTGAGCATTTAACTCAGG + Intergenic
950757179 3:15185041-15185063 TATAGTTGAGCATTCCACAGAGG - Intergenic
956371328 3:68565182-68565204 CATAGCTAAGCATTTCATCCTGG - Intergenic
962933321 3:140057361-140057383 TATAGCTGAGCAGATCAAGCTGG + Intronic
962933866 3:140061459-140061481 CATGGCTGTGGATTTCACACAGG + Intronic
963108673 3:141666854-141666876 TCAAGATGAGCATTACACACTGG + Intergenic
964336159 3:155656663-155656685 TATGTCTGAGGAATTCACACAGG - Intronic
965462096 3:168978511-168978533 TAGAGCTGAGATTTTAACACAGG - Intergenic
966640149 3:182180677-182180699 TTTGGCTGAGCATTTCTCTCTGG + Intergenic
970537362 4:17042841-17042863 TATAGCTGAGCTTTTCTTAGTGG + Intergenic
972488060 4:39561073-39561095 TATTCCCAAGCATTTCACACAGG - Intronic
973057379 4:45678343-45678365 TATTGCTAAGCATTACACTCTGG + Intergenic
974507445 4:62794601-62794623 TATCATTGAGGATTTCACACAGG + Intergenic
975953890 4:79812210-79812232 TTTAGGTGAGAATTTCTCACAGG + Intergenic
976518289 4:85996835-85996857 GATAAATTAGCATTTCACACTGG + Intronic
979274236 4:118796971-118796993 TATAGCAGAGCAAGTCACACAGG - Intronic
979903353 4:126252109-126252131 TATACCTGAGCATTTCAGTTTGG - Intergenic
980649818 4:135697626-135697648 TACAGCTGGGCCCTTCACACAGG + Intergenic
981609183 4:146574711-146574733 TATTGCTGGGCATTTCACTTGGG - Intergenic
982890734 4:160846381-160846403 TCTAGATGAACCTTTCACACAGG + Intergenic
991031477 5:62086547-62086569 TACAGCTGAGCATAGCACATAGG + Intergenic
992215001 5:74517169-74517191 CATAACTGAGCATTTTACAAAGG + Intergenic
997594630 5:135098475-135098497 TATATCTGAACATTTTACAATGG - Intronic
997629806 5:135358561-135358583 TATGGCTGACCATTTTATACTGG + Intronic
1000041306 5:157487117-157487139 TATAGCAGAGTACTGCACACTGG - Intronic
1000881468 5:166703009-166703031 TATAGTTGAGATTTTCAGACAGG - Intergenic
1004209724 6:13627035-13627057 TATTGCTGAGTATTTCATTCTGG + Intronic
1005048384 6:21663488-21663510 TATAGCAGAGCATATCAGCCAGG - Intergenic
1007258360 6:40544420-40544442 TACTGCTGAGCATTTCTCAGTGG + Intronic
1009725916 6:67535964-67535986 TTTAGCTGAGTATTTCACAAGGG + Intergenic
1012111272 6:95237923-95237945 TATAGCAGGGCATTTCATCCTGG - Intergenic
1016118502 6:140318125-140318147 AATAGATGAGCATTTCCCAGTGG - Intergenic
1016504452 6:144763025-144763047 TATAGCTCAGTTTTTCCCACTGG + Intronic
1022904817 7:34845497-34845519 GAGAGCAGAGCATTTCAGACAGG - Intronic
1023150164 7:37194522-37194544 TAAAGCTGAGGATTTCACTTCGG - Intronic
1024394459 7:48849643-48849665 TTTACATGAGCATTTCACTCGGG - Intergenic
1024400807 7:48922998-48923020 TTTACATGAGCATTTCACTCGGG + Intergenic
1024842218 7:53600336-53600358 CATATCTGTGCAGTTCACACGGG + Intergenic
1028087137 7:86650136-86650158 TATAGCAGAGTTCTTCACACAGG - Intronic
1029881628 7:103817593-103817615 TATAACTAAGCTTTTCACAAAGG - Intronic
1030796898 7:113800033-113800055 TATAACTGAGCAATTAACACAGG + Intergenic
1033754246 7:144384864-144384886 TTTACCTGAGCATTTCAGAGAGG + Intergenic
1034359251 7:150479728-150479750 TATGGCTGAGCAGGTGACACTGG + Intergenic
1034761036 7:153672052-153672074 TATAGCTGAGCACTAAACACAGG - Intergenic
1035253230 7:157610850-157610872 TTGAGCTGAGCATTTCCCAAAGG - Intronic
1037302402 8:17466383-17466405 TATAGCAGAGAATTTGTCACGGG + Intergenic
1037948403 8:23003690-23003712 TGTAGCTGAGCATGACACATGGG + Intronic
1038768864 8:30457386-30457408 TATAAATAAGCATTTCAGACTGG + Intronic
1039669558 8:39581062-39581084 TATCGCAGAGCATTACACATGGG + Intergenic
1042470813 8:69185873-69185895 TATGACTGAGCCTGTCACACAGG + Intergenic
1052347878 9:27428233-27428255 TATATCTGTGCTTCTCACACTGG + Intronic
1052388038 9:27845328-27845350 TATACCTGAGAATTTCCCAGAGG + Intergenic
1054773476 9:69104755-69104777 TATAGCTGTGGCTTTCTCACTGG + Intergenic
1054912074 9:70464261-70464283 TATAGGTGACCATTTCAGATTGG - Intergenic
1055398051 9:75893823-75893845 AATAGCTGATCTTTTTACACTGG - Intronic
1056042573 9:82683446-82683468 TACAGCTGAGAAGTTGACACGGG - Intergenic
1058990455 9:110250775-110250797 TACTGCTGAGCTTTTCACATTGG - Intronic
1188765306 X:34083288-34083310 ATTAGCTGAGCATTTCATATTGG - Intergenic
1190155023 X:47983369-47983391 TGTAGCTGTGGATTTCACCCAGG - Exonic
1195776912 X:108416428-108416450 TTTTGCTGAGGATTTCACTCAGG - Intronic
1198630699 X:138634950-138634972 TATAGCAGCGCAATTCACAATGG + Intronic
1200892563 Y:8339482-8339504 TATAGCTGAGCCCATCACTCAGG + Intergenic
1202070608 Y:20988076-20988098 TATTGCTGAGCCTTGCACCCAGG - Intergenic