ID: 1129342777

View in Genome Browser
Species Human (GRCh38)
Location 15:74897110-74897132
Sequence CCTGTCCTTGCTGGAGCTAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342777_1129342782 -5 Left 1129342777 15:74897110-74897132 CCCCTAGCTCCAGCAAGGACAGG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1129342782 15:74897128-74897150 ACAGGCTCTTTCTCCCAACACGG 0: 1
1: 0
2: 1
3: 11
4: 202
1129342777_1129342783 2 Left 1129342777 15:74897110-74897132 CCCCTAGCTCCAGCAAGGACAGG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342777 Original CRISPR CCTGTCCTTGCTGGAGCTAG GGG (reversed) Exonic
900196905 1:1381130-1381152 CCTGGCCTTGCTGCAGGCAGGGG + Intergenic
900252369 1:1677852-1677874 TCTGACCTTCCTGGAGCTCGTGG - Intronic
900338609 1:2177164-2177186 CCTGGCCTAGCTGGTGTTAGTGG + Intronic
900782917 1:4629500-4629522 CCTGTCCCTGCAGGAGCTCGGGG + Intergenic
901325465 1:8362713-8362735 ACTGTCATTGCTGGAGGTACTGG + Exonic
901436259 1:9249029-9249051 CCTGCCCCTGCTGAAGCCAGCGG + Intronic
901773401 1:11542839-11542861 CCTGTCCTTGCTGCAGCGGGAGG + Intergenic
901877715 1:12176281-12176303 GCTGTCCTAGCTGGAGCCAAAGG + Intronic
901927201 1:12573932-12573954 CCTGCCCTTCCTGGATCTATAGG + Intronic
902845098 1:19104153-19104175 CCTGTGCTTGCGGAAGCTGGTGG - Exonic
905658051 1:39698814-39698836 GCTGTCATTGCCAGAGCTAGGGG + Intronic
906065595 1:42978224-42978246 TCTGTCCTTGCTGGATCCAGAGG - Intergenic
906129631 1:43448358-43448380 CCTCTTCTTGCTGGAGCCACCGG + Exonic
906606290 1:47174748-47174770 CCTGTCCTGGCTTGGGCTGGGGG - Intergenic
913478284 1:119260163-119260185 CCTGCCCTTGCTGAAGGAAGGGG - Intergenic
914762989 1:150614102-150614124 CCTGCCATTGCTGGAACTACAGG + Intronic
915356350 1:155257230-155257252 CCAGTGCTGGCTGGATCTAGAGG + Intronic
915843045 1:159232401-159232423 CCAGTCCTTGCTGGCGCCATAGG + Intergenic
915980250 1:160415887-160415909 CCTGTGCTTGCGGGAGCTGCGGG - Exonic
916151948 1:161802123-161802145 CCAGTCCTTGCTGTTGCTGGGGG + Exonic
917836571 1:178946126-178946148 CCTGTCCTTGGTGAACCGAGGGG + Intergenic
920034173 1:203055382-203055404 CTGGTCCTGGCTGGGGCTAGTGG + Intronic
920433558 1:205934242-205934264 CCTGTCCTTTCTGGGGCTCATGG + Intronic
920785779 1:209039833-209039855 CCTGCCCTTGTGGGAGCTAAAGG + Intergenic
1063499283 10:6538320-6538342 TCTTTCCTTGCTGGACCTCGGGG + Intronic
1065860218 10:29866384-29866406 ACTATCCTAGCTGGAGCAAGGGG + Intergenic
1067183995 10:44011819-44011841 CCTGTGCTGGCTGGAGCTCTGGG - Intergenic
1069579888 10:69558824-69558846 CCTGCCCTTGTTGGGGTTAGGGG + Intergenic
1070340746 10:75495860-75495882 CCTGTCTTTCCTAGAGCTTGGGG - Intronic
1072275730 10:93820862-93820884 CCTCTCCTTGTTGGGGCCAGGGG - Intergenic
1072955374 10:99883537-99883559 CCTGTCCTAGCTGGGACTACAGG - Intronic
1074431862 10:113401253-113401275 CCTGACCTTGCTGGAGCATTCGG - Intergenic
1074543931 10:114387938-114387960 CCTGTACTTACTGGGGGTAGGGG - Intronic
1075191865 10:120316532-120316554 GCTGTGGTTACTGGAGCTAGAGG - Intergenic
1075736352 10:124666818-124666840 GCTGTCCATGGTGGAACTAGAGG - Intronic
1076215969 10:128693609-128693631 CCTGTCCCTGCTGCAGCTACTGG + Intergenic
1077080626 11:723067-723089 CCTCTCCTGGCAGGGGCTAGGGG - Intronic
1077300924 11:1846579-1846601 CCAGGCCTTGCTGGGGCTGGGGG - Intergenic
1078089697 11:8257301-8257323 CCTGTCCTGTCTGGAGTTGGAGG - Intronic
1080608169 11:33881832-33881854 CCTGAACTTGCAGTAGCTAGTGG - Exonic
1081118868 11:39239006-39239028 ACTGTAATAGCTGGAGCTAGAGG - Intergenic
1081579610 11:44343296-44343318 CATGTCCTGGCTGGATGTAGTGG - Intergenic
1083331243 11:61899326-61899348 CCAGGCCTTGCTGGATGTAGCGG + Exonic
1085041757 11:73330961-73330983 CCTGGCCTTCCTGGATCCAGAGG - Intronic
1085509422 11:77080617-77080639 CCTGGACCTGCTGGAGGTAGCGG - Intronic
1086097979 11:83069608-83069630 CTTATCCTTGCTGCAGCTGGTGG - Intronic
1087150155 11:94852298-94852320 CCTGTCCTAGCTGAAGCCACTGG - Intronic
1087618226 11:100513243-100513265 CCACTCATTGCTGGAGCCAGGGG + Intergenic
1088889642 11:114034648-114034670 CCTGTCCTTTCAGGAGGCAGAGG - Intergenic
1089454053 11:118615533-118615555 GCTGTTCTTGCTGCAGTTAGGGG + Intronic
1089500808 11:118930152-118930174 TTAGTCCTCGCTGGAGCTAGGGG - Intronic
1089656244 11:119948872-119948894 CCTGGCCTTGGGGGAACTAGGGG - Intergenic
1089796967 11:120988598-120988620 CCTCACCTTGCTCAAGCTAGTGG + Exonic
1090515575 11:127423265-127423287 GCTGTGCTGCCTGGAGCTAGAGG + Intergenic
1090934431 11:131329157-131329179 CCTGCCCTTACTGGGGCAAGAGG - Intergenic
1093701611 12:22228338-22228360 CCTCTCCTTGCTGCAGTTAGTGG + Intronic
1093808475 12:23464697-23464719 TCTGTCCTGGCTGGAGTTATTGG - Intergenic
1100327185 12:93550794-93550816 CCTGTCCTTTCAGGAGTGAGTGG + Intergenic
1100620893 12:96271803-96271825 CCTCTCCTTCATGGAGCTTGTGG + Intergenic
1104602078 12:130161365-130161387 CGTGTCCTCGCGGGAGCTGGGGG + Intergenic
1104716507 12:131019788-131019810 CCTGCCCTGGATGGAGCTCGGGG - Intronic
1104716542 12:131019898-131019920 CCTGCCCTTGATGGAGCTCAGGG - Intronic
1104716622 12:131020171-131020193 CCTGCCCTGGATGGAGCTCGCGG - Intronic
1104716638 12:131020226-131020248 CCTGCCCTGGATGGAGCTCGGGG - Intronic
1104716656 12:131020281-131020303 CCTGCCCTGGATGGAGCTTGGGG - Intronic
1104716689 12:131020390-131020412 CCTGCCCTGGCCGGAGCTTGGGG - Intronic
1110127914 13:71970402-71970424 CCTGTCCTTCATTGAGCTAAAGG + Intergenic
1111465475 13:88603031-88603053 CCTATCATTGCTGGAGGTGGGGG - Intergenic
1113601638 13:111573529-111573551 CCTGTCATTGCTGGGGAAAGTGG + Intergenic
1113892553 13:113744018-113744040 CCTGCCCCTCCTGGAGCTTGGGG + Intergenic
1116503717 14:45652070-45652092 CCCATCCTAGCTGGAGCTTGTGG + Intergenic
1116847634 14:49879856-49879878 TCTTTCCTTGCTGGTGTTAGAGG - Intergenic
1116937559 14:50757861-50757883 CCTGTCCCTGCTTCAGCAAGGGG - Exonic
1118797360 14:69154940-69154962 CCAGTACTTGCTGGCACTAGTGG + Intergenic
1121021893 14:90585296-90585318 CCTGTCACTGCTGCAGCTAGGGG - Intronic
1123096647 14:105770061-105770083 CCTGTCCTGCCTTGAGCTGGAGG + Intergenic
1124251173 15:28107181-28107203 GCGGTCCTTGGTTGAGCTAGCGG - Intergenic
1124594850 15:31083787-31083809 CCTGTGCTCTCTGCAGCTAGGGG - Intronic
1124785247 15:32673013-32673035 GCTCTCCTGGCTGGGGCTAGTGG - Intronic
1126661594 15:51038584-51038606 GCAGTCCTTGCTGGAGTTGGTGG + Intergenic
1128224849 15:65994477-65994499 CCTATTCATGCTGGAGCTGGGGG + Intronic
1129342777 15:74897110-74897132 CCTGTCCTTGCTGGAGCTAGGGG - Exonic
1129570197 15:76674466-76674488 CCAGTCCTTCCTGTAGCTTGAGG + Intronic
1130415770 15:83693386-83693408 CCTGGCCAGGCTGGAGCTGGAGG + Intronic
1130649769 15:85755950-85755972 CCTGTCCTTTCTGCAGGTAAAGG - Intergenic
1131109980 15:89758907-89758929 CCTGTCCCTGCCGGAGCCAGAGG + Intergenic
1131324325 15:91427947-91427969 TTTTTTCTTGCTGGAGCTAGAGG + Intergenic
1132292292 15:100712241-100712263 CCTGGCCTTGCTGGTGCTGATGG + Intergenic
1132475821 16:137498-137520 CCTGTGCTTGCTAGAACTGGGGG + Intronic
1132852825 16:2032616-2032638 TCTGTCCTGGCTGGGGATAGGGG + Intronic
1133113523 16:3563550-3563572 CCTGTCCCTGCAGGAGTTTGTGG - Exonic
1134135984 16:11676546-11676568 CCTGACCTTGCTGGGGCTCATGG + Exonic
1135908793 16:26540596-26540618 CTTGACATTGCTGGAGCTATGGG - Intergenic
1135971964 16:27078838-27078860 CATGTCCTTCCTGGAGCTGCAGG - Intergenic
1136389053 16:29950849-29950871 GCTGAGCTTCCTGGAGCTAGGGG + Intronic
1140245515 16:73244725-73244747 CCTGTCCTTCCTCAAGCTGGTGG - Intergenic
1142172711 16:88631124-88631146 CGTGACCTTGCTGGAGCTCTTGG - Exonic
1142193103 16:88726897-88726919 CCTGTTCTGGCTGGTGCTGGTGG - Exonic
1142673424 17:1498213-1498235 CCAGTAGTTGCTGGAGTTAGGGG - Intronic
1144290889 17:13825155-13825177 TCTGTCCATGCTTGTGCTAGGGG + Intergenic
1144340752 17:14309098-14309120 CCGCTCCTTTCGGGAGCTAGGGG + Intronic
1147876901 17:43628166-43628188 CCTGTCCTTGAGTGTGCTAGTGG - Intergenic
1148753923 17:49962723-49962745 CCTGTCCAGGCTGGACCTTGGGG - Intergenic
1149553337 17:57555886-57555908 CCTGTCCTGGCTGTAGGGAGAGG - Intronic
1149662726 17:58343792-58343814 CCAGTCCTTTCTTGAGCTGGAGG + Intergenic
1151679787 17:75617161-75617183 CTTTTCCTTGATGGAGCTAGAGG - Intergenic
1152282362 17:79392507-79392529 CCTGTTCCTGCTGGAGCCACGGG + Intronic
1158639929 18:59195148-59195170 CCTGACCTAGCTGGAGCTGTGGG - Intergenic
1160030163 18:75250435-75250457 CCTGTCCTCCCTGCAGCAAGGGG + Intronic
1160115526 18:76075552-76075574 TCAGTCCTTGCTGGAGCTATGGG - Intergenic
1160307442 18:77753285-77753307 CCTGGCCTTCCTGGAGCTGCAGG + Intergenic
1160830288 19:1101422-1101444 CCAGTCCTTCCTGGAGCCAGGGG + Intergenic
1161411176 19:4118329-4118351 TCTGTCTTTGCAGGAGATAGAGG + Intronic
1161951669 19:7471105-7471127 CCCGCCCTGGCTGAAGCTAGAGG - Exonic
1162503018 19:11065278-11065300 CATGGCCTGGCTGGAGCTGGGGG + Intronic
1163321891 19:16579605-16579627 CCTGTAGTTGCTGGAGGTGGTGG - Intronic
1163584306 19:18155743-18155765 CCTGTGACTGCTGGAGATAGAGG + Exonic
1164990137 19:32676851-32676873 CGTGTCCTTGCAGGAGCGCGGGG + Exonic
1166916056 19:46196744-46196766 TCTGTCCTGACTGGAGCTCGAGG - Intergenic
1168307371 19:55442810-55442832 CCTGGCCTGGCCGGCGCTAGAGG + Exonic
1168458803 19:56537651-56537673 CTTGTCCTTTCTGCAGCTTGCGG + Intergenic
1168646677 19:58063471-58063493 CATCTCCCTGCTGGAGCAAGAGG + Exonic
926299579 2:11592953-11592975 GCTGTCGTTGCAGGAGCTGGCGG - Exonic
926516376 2:13851417-13851439 CCTGATCTTGCTGGAGCTGGGGG - Intergenic
927107535 2:19840884-19840906 CCTGTTCTGGCTTGACCTAGGGG - Intergenic
928215487 2:29357752-29357774 GCTGACCTTGCAGGAGGTAGGGG + Intronic
928220791 2:29401263-29401285 TCTGTCCTTGGTGGAGGTGGTGG + Intronic
928262076 2:29777065-29777087 CCTGCCCTTGCTGTAGTTTGAGG - Intronic
928380554 2:30814146-30814168 CCTGTCCTTGCTGGAGAAGCGGG + Intronic
929875287 2:45791738-45791760 TCTGCCCTTGCTGGTGCTAAAGG + Intronic
932494953 2:72141590-72141612 CCGGTCCATGCTGCAGTTAGAGG - Intronic
932569970 2:72933482-72933504 CTTGGCTTTGCTGGGGCTAGAGG + Intronic
933074362 2:77904907-77904929 CCTCTCCTTGCTGGAGAGATGGG + Intergenic
934653838 2:96107269-96107291 CCTGGCCTTGGCTGAGCTAGAGG - Intergenic
935551517 2:104462670-104462692 CTTGTGCTTGATGGAGCCAGGGG - Intergenic
938312931 2:130305866-130305888 GCTGTCCTGGCTTGAGCTACAGG - Intergenic
939672536 2:145030794-145030816 TCTATCTTTGCTGGAACTAGAGG - Intergenic
940726804 2:157343997-157344019 GCTGCCCTTGCTGGAGCTCTAGG + Intergenic
940802931 2:158153485-158153507 GCTGTGCTGCCTGGAGCTAGGGG - Intergenic
942044636 2:172093017-172093039 TCTGTCTACGCTGGAGCTAGGGG - Intergenic
943208090 2:184927368-184927390 TCTGAGCTGGCTGGAGCTAGGGG + Intronic
943685290 2:190811543-190811565 CCTGTGCTTCCTGGGGCTAAGGG + Intergenic
947116839 2:226781053-226781075 CCTGTCCTTGCTTCAGTTACTGG - Intronic
1168798512 20:628580-628602 CTTTTCCTGTCTGGAGCTAGAGG + Intergenic
1169833483 20:9852063-9852085 CCTGACCTAGCTGGAGTTAAAGG + Intergenic
1171322764 20:24260845-24260867 CCTGCCCTTCCTGGAGCAAAGGG + Intergenic
1171378501 20:24713698-24713720 CCTGGCCTTGCTGGAGATCTAGG - Intergenic
1173687235 20:44932230-44932252 CCAGTCCCTGCAGGAGCCAGTGG + Intronic
1174109846 20:48191393-48191415 CATGTCCCTGCTGGAGTAAGAGG + Intergenic
1174262388 20:49305998-49306020 CCTTACCTTGATGGAGCAAGAGG + Intergenic
1176286984 21:5023514-5023536 CCTGTCCATGCTGGGTCTTGAGG + Intronic
1179870197 21:44239961-44239983 CCTGTCCATGCTGGGTCTTGAGG - Intronic
1180820617 22:18824782-18824804 GCTGTCCTGGCTGGAGCCGGTGG - Intergenic
1181206840 22:21259254-21259276 GCTGTCCTGGCTGGAGCCGGTGG - Intergenic
1181466343 22:23112605-23112627 CCTGTCCTTGCTGGAGAAGGGGG - Intronic
1183324906 22:37185900-37185922 CATGTGTTTGCTGGAGATAGTGG - Intronic
1183714898 22:39527902-39527924 CCTGTTCTTCCAGGCGCTAGAGG + Intergenic
1184014184 22:41773172-41773194 CCTCTCCTTTCTGGAGGTGGTGG + Intronic
1203220083 22_KI270731v1_random:36169-36191 GCTGTCCTGGCTGGAGCCGGTGG + Intergenic
1203270743 22_KI270734v1_random:50657-50679 GCTGTCCTGGCTGGAGCCGGTGG - Intergenic
949448418 3:4161196-4161218 GCTGTGCTGCCTGGAGCTAGGGG + Intronic
951251903 3:20403792-20403814 CCTGAACTTCCTGGATCTAGAGG - Intergenic
952797697 3:37256681-37256703 CCTGTCCTTGTTGTTGCTTGAGG + Intronic
953927005 3:46987775-46987797 CCTGTCCTGGGTGGGGCTTGTGG - Intronic
954434866 3:50490586-50490608 CCTGGCTTTGCTGGAGCCAGAGG - Intronic
955238343 3:57159620-57159642 GCTGTCTGTGCTGGAGCTACAGG - Intronic
958750241 3:98186816-98186838 CCTGTCCTTGATGGACCAACTGG + Intronic
958755847 3:98248385-98248407 GCTGTCCTTGCTGGATCTTTAGG + Intergenic
961332643 3:126152041-126152063 CCAGCCCTTGCTGCAGCTGGAGG - Intronic
961356293 3:126341997-126342019 CCTGTGCTGGCTGGAGCCTGGGG - Intergenic
961573935 3:127819864-127819886 CCTGTGCTTGCTGGATCTTGGGG - Intronic
965318468 3:167221630-167221652 CCTTTCATTGCTGGTGCTTGTGG - Intergenic
965803532 3:172518348-172518370 CCAGTCCTTGATGGGGCTTGAGG + Intronic
966827613 3:183978265-183978287 CCTCTCCTTACTGGACCTGGAGG - Intronic
966920731 3:184609934-184609956 CCTGTGCTGGCTGCTGCTAGGGG + Intronic
969128409 4:4971896-4971918 TCTGTCCTTTCTGGAGGTTGGGG + Intergenic
969671930 4:8594401-8594423 CCTGTCCTCACTGGAGCCTGGGG + Intronic
969722026 4:8897394-8897416 CTTATCCTGGCTGGAGCTGGGGG + Intergenic
970421240 4:15907222-15907244 CCTGGCCTGGTTGGAGCTACAGG - Intergenic
974069906 4:57114061-57114083 CCTGTACTGGCTGGACATAGAGG - Intergenic
974148941 4:57980931-57980953 TTTGTACTTTCTGGAGCTAGGGG + Intergenic
977117603 4:93050728-93050750 CCTGTCCTAGATGAAGCTACAGG + Intronic
978442726 4:108750751-108750773 CTTGTACTTGCTGGATCTTGGGG + Intronic
980683019 4:136187972-136187994 TCTGAGCTGGCTGGAGCTAGGGG - Intergenic
989118056 5:37976035-37976057 CCTCTGCTTGCTGGAGATACAGG + Intergenic
994017251 5:94981788-94981810 TCTAACATTGCTGGAGCTAGTGG + Intronic
994908410 5:105869343-105869365 TCTGTCCCTGCTGGAGTTATGGG + Intergenic
997424329 5:133792977-133792999 ACTGTCCTTGCTGGCTCTGGCGG + Intergenic
999128432 5:149264324-149264346 ACTGTCCCTGCTGGAGCTCATGG - Intergenic
999285973 5:150394519-150394541 CCTGACCCTACTGGAGCTAAGGG + Intronic
999417781 5:151414927-151414949 CCTGCCCCTTCTGGAGCTGGAGG - Intergenic
1001270249 5:170305796-170305818 CCTGCCCTTACTGGAACTGGAGG + Intergenic
1001929697 5:175664167-175664189 CCAGTCCTTGCTGGAGCTGGAGG - Intronic
1001964689 5:175901936-175901958 GCTGTCCTCACTGGAGCAAGAGG - Intergenic
1004551579 6:16653247-16653269 CATGCCCTTGCTGGAACAAGAGG + Intronic
1005395206 6:25375526-25375548 CCTGGCCTTGCTGGAGATTTAGG - Intronic
1007114871 6:39336297-39336319 CCTGTGGTTGCTGGAGCTGCTGG - Exonic
1007252076 6:40502551-40502573 CCTGTCCTTCCTGGAACGATGGG + Intronic
1008643857 6:53493441-53493463 CCTGGCGTTGCTGGAGCTGCTGG + Intergenic
1009975171 6:70664341-70664363 CCTGTGACTGCTGGACCTAGAGG + Intergenic
1011341074 6:86314497-86314519 GCTGAGCTTCCTGGAGCTAGGGG - Intergenic
1014874311 6:126637997-126638019 CTTGTCCTTGCTGTAGCTCCAGG + Intergenic
1018240304 6:161767749-161767771 CCTGTCCTGGCTGGGGGTGGGGG + Intronic
1018818864 6:167357632-167357654 CCTGTCCTCGCTGGGACAAGAGG - Intronic
1020211360 7:6160083-6160105 CCTGACCCTTGTGGAGCTAGAGG + Intronic
1021048991 7:15958899-15958921 GCTGTACTTGTAGGAGCTAGAGG + Intergenic
1024159492 7:46659564-46659586 CCTGTCGTTGCAGGAGATAAAGG + Intergenic
1026330888 7:69351659-69351681 CCTGGCCTCGCTGTAGGTAGGGG - Intergenic
1026410619 7:70118125-70118147 TCTGTCCTGGCTTGAGCTAAAGG - Exonic
1027222145 7:76220819-76220841 GCTGCCCCTGCTGGAGCTGGAGG - Intronic
1029193256 7:98786555-98786577 CCTGGCCTTGCTGGGGATGGGGG + Intergenic
1030217268 7:107057194-107057216 CAGGTCTGTGCTGGAGCTAGAGG - Intronic
1033605836 7:142928108-142928130 GCTGTCCTTCCTGGAGCTTGTGG - Exonic
1034498093 7:151433808-151433830 CCTGTCCTGGCTGTGGCTACTGG + Intronic
1035085314 7:156253144-156253166 CCTGTTCTCTCTGGAGCTGGGGG - Intergenic
1036224420 8:6945542-6945564 CCTGTCCCAGCTGGATCTACAGG - Intergenic
1036644310 8:10602273-10602295 CCAGTCCTGGCTGGATCCAGCGG + Intergenic
1037193148 8:16152313-16152335 CCTGTCCTTGCTGAAGCTTTAGG + Intronic
1046645158 8:116777807-116777829 TGTGTCCATTCTGGAGCTAGAGG + Intronic
1051511088 9:17878706-17878728 CCTGTACTTGCTGGACCATGGGG - Intergenic
1058901539 9:109446619-109446641 AGTGTCCTTGCTGGAGAAAGAGG + Intronic
1062631999 9:137467255-137467277 CAGGTCCTTGCTGGTGCTGGGGG - Intronic
1192763811 X:74122982-74123004 GCTGTCCTTGCTGGATCTCTAGG - Intergenic
1195294942 X:103466771-103466793 CCTGTGATTCCTGGAGCTGGGGG - Intergenic
1197874777 X:131091169-131091191 CCTGTCCTTTCTGGAGAGAAAGG - Intergenic
1198236544 X:134740835-134740857 CTCTTCCTTCCTGGAGCTAGTGG - Intronic
1202167061 Y:22000857-22000879 ACTTTCCTTGCTGGAGATGGAGG + Intergenic
1202224299 Y:22585516-22585538 ACTTTCCTTGCTGGAGATGGAGG - Intergenic
1202318815 Y:23610144-23610166 ACTTTCCTTGCTGGAGATGGAGG + Intergenic
1202551953 Y:26059913-26059935 ACTTTCCTTGCTGGAGATGGAGG - Intergenic