ID: 1129342779

View in Genome Browser
Species Human (GRCh38)
Location 15:74897111-74897133
Sequence GCCTGTCCTTGCTGGAGCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342779_1129342782 -6 Left 1129342779 15:74897111-74897133 CCCTAGCTCCAGCAAGGACAGGC 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1129342782 15:74897128-74897150 ACAGGCTCTTTCTCCCAACACGG 0: 1
1: 0
2: 1
3: 11
4: 202
1129342779_1129342783 1 Left 1129342779 15:74897111-74897133 CCCTAGCTCCAGCAAGGACAGGC 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342779 Original CRISPR GCCTGTCCTTGCTGGAGCTA GGG (reversed) Exonic
900196903 1:1381129-1381151 GCCTGGCCTTGCTGCAGGCAGGG + Intergenic
900352679 1:2243376-2243398 GCCTGCCCTTTCTGCAGCTGTGG + Intronic
900782915 1:4629499-4629521 TCCTGTCCCTGCAGGAGCTCGGG + Intergenic
900987233 1:6080286-6080308 GTCTGTCCGTGCTGGAGCCCTGG + Intronic
901049761 1:6420208-6420230 GCCTTGCCTGACTGGAGCTACGG + Intronic
901054791 1:6444061-6444083 GGCTCTCCTTGCTGGACCTGGGG - Intronic
905370438 1:37480035-37480057 GCCTGGCCATCCTGGAGCTGTGG + Intronic
905658050 1:39698813-39698835 GGCTGTCATTGCCAGAGCTAGGG + Intronic
911242763 1:95483458-95483480 GCTTTTCCCTGCTGGAGCTGGGG + Intergenic
913539229 1:119803022-119803044 GCCTGGCCTTTCTAGAGCAAAGG - Intronic
915980252 1:160415888-160415910 ACCTGTGCTTGCGGGAGCTGCGG - Exonic
916012247 1:160716886-160716908 GCCTGTCATTGCTGGTGGTGTGG - Intergenic
916151946 1:161802122-161802144 GCCAGTCCTTGCTGTTGCTGGGG + Exonic
916391311 1:164333820-164333842 GCCTCTCCCTGCTGGAGGAAGGG + Intergenic
917514594 1:175697134-175697156 GCCTGACTTTGCTGGTCCTAGGG - Intronic
917836569 1:178946125-178946147 GCCTGTCCTTGGTGAACCGAGGG + Intergenic
919897684 1:202019313-202019335 GCCTGTCCTGACTGGAGGCAAGG - Intergenic
920492830 1:206431012-206431034 GAGTGACCTTTCTGGAGCTAAGG + Intronic
1063499282 10:6538319-6538341 GTCTTTCCTTGCTGGACCTCGGG + Intronic
1064888143 10:20135633-20135655 TCCTGTTCTTTCTGGAGCTGTGG + Intronic
1067183997 10:44011820-44011842 GCCTGTGCTGGCTGGAGCTCTGG - Intergenic
1070340748 10:75495861-75495883 GCCTGTCTTTCCTAGAGCTTGGG - Intronic
1070392581 10:75984226-75984248 GCCTGGCCTTGCAGGACCCAGGG - Intronic
1070399861 10:76044103-76044125 GGCTGTCCTTCCTGGAACAAGGG + Intronic
1071835583 10:89414606-89414628 TCCTGTTCTTGCTGGGGCTGGGG + Exonic
1072058039 10:91780226-91780248 GCCTGTTCTTGCTTCAGCTAGGG + Intergenic
1073152393 10:101321050-101321072 GCCTGTCCTGCATGGAGCTCAGG - Intergenic
1074543933 10:114387939-114387961 GCCTGTACTTACTGGGGGTAGGG - Intronic
1077080628 11:723068-723090 GCCTCTCCTGGCAGGGGCTAGGG - Intronic
1077300926 11:1846580-1846602 GCCAGGCCTTGCTGGGGCTGGGG - Intergenic
1077403424 11:2369941-2369963 GCCTGTCAATGCTGGACATAGGG + Intergenic
1080595630 11:33772479-33772501 GGCTGGCGTTGCTGGAGGTAGGG - Intronic
1083629292 11:64087502-64087524 GCCACCCCTTGCTGGAGCTCTGG + Intronic
1085395197 11:76203576-76203598 GCCTGGCCTGGGTGGAGGTAAGG + Intronic
1088359233 11:108973766-108973788 GCCTGTCCTAGCAGGACCTCAGG + Intergenic
1089454052 11:118615532-118615554 GGCTGTTCTTGCTGCAGTTAGGG + Intronic
1089642594 11:119857591-119857613 GCCTGTTCTTGCAGAAGCCAGGG + Intergenic
1090734399 11:129598623-129598645 GCTTTTCCCTGCTGGAGCCAGGG + Intergenic
1091949506 12:4581159-4581181 GCCTGTGCTTGCTGGGGGTCAGG + Intronic
1092277447 12:7072429-7072451 TCCTGTCATTGCAGGAGCAATGG + Intergenic
1096244410 12:49976079-49976101 GCCTGTCCTCTCTGGACCAAGGG - Exonic
1098156710 12:67607078-67607100 CCCAGTCCTTGCTGAAGTTAAGG + Intergenic
1099191898 12:79569742-79569764 GACTGTCATTGCTGGAACTGGGG + Intergenic
1101834967 12:108288687-108288709 CCCTGTCCTTGCTGGCTCAAGGG + Exonic
1102429063 12:112867578-112867600 ACCTGTTTTTGCTGGTGCTAGGG - Intronic
1102644573 12:114395857-114395879 GCACGTTCTTGCTGGAGCCAGGG + Intronic
1104589126 12:130070309-130070331 GCCTGTGCTTGCGGGAGGTGAGG - Intergenic
1104716544 12:131019899-131019921 CCCTGCCCTTGATGGAGCTCAGG - Intronic
1106101089 13:26695572-26695594 GCCTGTCCCAGCTGGGGCCACGG - Intergenic
1108090583 13:46845371-46845393 GCCTGGACTTGCTGGGGCTGAGG + Intronic
1110739978 13:78983593-78983615 CACTGTCCTTGCTGCAGCTCTGG + Intergenic
1113892551 13:113744017-113744039 GCCTGCCCCTCCTGGAGCTTGGG + Intergenic
1116524805 14:45891398-45891420 CCCTCTCCTTCCTGAAGCTATGG - Intergenic
1121021895 14:90585297-90585319 GCCTGTCACTGCTGCAGCTAGGG - Intronic
1121648204 14:95535369-95535391 GCCTGACCTTGTCGGAGCTCCGG - Exonic
1122165116 14:99817464-99817486 GCCTGTCCCGGCTGGTGCTGAGG + Intronic
1122740568 14:103869545-103869567 GCCTGCCCCGGCTGGAGCTCCGG + Intergenic
1125543835 15:40488367-40488389 GCCTGTCCTTGCCTCAGCCATGG + Intergenic
1125544108 15:40489839-40489861 GCCTGTCCTTGCCTCAGCCATGG + Intergenic
1125826253 15:42678955-42678977 GCCTCTCCTTGCAGGTCCTATGG + Intronic
1125854761 15:42938308-42938330 GCCTATCCTGGCTGCAGCTCAGG + Intergenic
1128113646 15:65092251-65092273 GCCTCTGCTTGCTTGAGTTATGG + Intergenic
1128691157 15:69725954-69725976 GGCTGTCCTGTCTGGAGCTAGGG - Intergenic
1129147215 15:73659464-73659486 GCGTGTCCTTGTTGGAGTTGGGG + Intergenic
1129202221 15:74009935-74009957 GCCTCTACTTTCTGCAGCTATGG + Intronic
1129342779 15:74897111-74897133 GCCTGTCCTTGCTGGAGCTAGGG - Exonic
1130081256 15:80735588-80735610 GCCCGCCCTGGCTGGAGCGAGGG - Intronic
1132111841 15:99107218-99107240 CCCTGTCCCTGCTCTAGCTATGG - Intronic
1133453591 16:5923415-5923437 CCCTGTCCTTGCTGGAGCTGGGG - Intergenic
1135527441 16:23224811-23224833 GCCTGTCACTGCTGGAGTAATGG - Intergenic
1135908794 16:26540597-26540619 CCTTGACATTGCTGGAGCTATGG - Intergenic
1137669875 16:50272714-50272736 GCATCTCCTTGCTGGAGCAGGGG + Intronic
1203139873 16_KI270728v1_random:1755672-1755694 GCCTGTCCTTTCTGTGGCTGGGG - Intergenic
1142568368 17:855606-855628 GCCTGTACTTGCTGGAGAATGGG - Intronic
1142673426 17:1498214-1498236 GCCAGTAGTTGCTGGAGTTAGGG - Intronic
1144785850 17:17831204-17831226 GCCAGTGCTTGGTGGAACTAGGG + Intronic
1145996919 17:29110203-29110225 GCATGTCCTGGCTGGTGCTGGGG - Intronic
1147332509 17:39707125-39707147 GCCTGTCCTTCCTGCAGGTGAGG + Exonic
1148161257 17:45451444-45451466 GCCTGCCCTTGGAGGAGTTAGGG - Intronic
1150453461 17:65288489-65288511 GCATGTCCATGCTGGGGCTGTGG - Intergenic
1150739067 17:67765052-67765074 GCCTGGCCTTGCTGGTGATGAGG - Intergenic
1152271774 17:79329111-79329133 GCCTGGCCCTGCGGGAGCCAGGG - Intronic
1152282360 17:79392506-79392528 TCCTGTTCCTGCTGGAGCCACGG + Intronic
1156091662 18:33479023-33479045 GCCTGTCAGTGTTGGAGGTAAGG - Intergenic
1158639931 18:59195149-59195171 CCCTGACCTAGCTGGAGCTGTGG - Intergenic
1160030161 18:75250434-75250456 GCCTGTCCTCCCTGCAGCAAGGG + Intronic
1160115527 18:76075553-76075575 GTCAGTCCTTGCTGGAGCTATGG - Intergenic
1160272864 18:77403618-77403640 CCCTGGCCTTGCTGGAGGTGGGG + Intergenic
1160830286 19:1101421-1101443 CCCAGTCCTTCCTGGAGCCAGGG + Intergenic
1160955691 19:1690795-1690817 GCCTCTCCCTGCAGGAGCTGAGG - Intergenic
1162199457 19:9010162-9010184 GGCTGTCCCTGCTGGGGCTTAGG + Intergenic
1163175931 19:15564086-15564108 GCCTGTCCTGGCTGGGCCTCGGG + Intergenic
1163186252 19:15641429-15641451 GCCTGTCCTCGCTGGGCCTTTGG + Exonic
1163202664 19:15779876-15779898 GCCTGTCCTGGCTGGGCCTCGGG - Intergenic
1163218460 19:15897576-15897598 GCCTGTCCTGGCTGGGCCTCTGG - Exonic
1163222832 19:15934373-15934395 GCCTGTCCTGGCTGGGCCTCGGG - Exonic
1164818272 19:31223827-31223849 GACTGTCCTAGCTGGAGCGGGGG + Intergenic
1167517014 19:49929377-49929399 GCCTCTCCTTGCTGCAGCCATGG + Exonic
925261198 2:2530041-2530063 GCCTGTGCTGGCTGGAGCAGTGG - Intergenic
925356278 2:3243810-3243832 GCCTGTCCTTGGGGCAGATATGG + Intronic
926516378 2:13851418-13851440 TCCTGATCTTGCTGGAGCTGGGG - Intergenic
928215486 2:29357751-29357773 GGCTGACCTTGCAGGAGGTAGGG + Intronic
928380552 2:30814145-30814167 TCCTGTCCTTGCTGGAGAAGCGG + Intronic
928898935 2:36297131-36297153 AGCTGACCTTGCTGGAGCTAGGG - Intergenic
929096658 2:38268817-38268839 GCATGTTATTGCTGGAGCTGAGG + Intergenic
929822710 2:45286206-45286228 GCCTGTCTTTCCTGGTGCTCTGG - Intergenic
930817878 2:55617644-55617666 GGCTGTCCTAGCAGGGGCTACGG + Intronic
932034007 2:68221795-68221817 TCCTGTCCTTGGTGTATCTAAGG - Intronic
933074360 2:77904906-77904928 TCCTCTCCTTGCTGGAGAGATGG + Intergenic
933141790 2:78800440-78800462 GCCTGTACTTGCCTGAGATATGG - Intergenic
933150635 2:78910939-78910961 TCCCATCCTTGCTGGAGCTAAGG - Intergenic
933897640 2:86825616-86825638 GCCTGAGCTGGCTGGAGCTCTGG - Intronic
934559989 2:95308238-95308260 GCCTCTTCTTGCTGCAGCTCTGG + Intronic
940014861 2:149093333-149093355 GCCTGTTGGTGCTGGAGCCAGGG + Intronic
942044637 2:172093018-172093040 GTCTGTCTACGCTGGAGCTAGGG - Intergenic
943685288 2:190811542-190811564 TCCTGTGCTTCCTGGGGCTAAGG + Intergenic
947384797 2:229580274-229580296 GAATGTCCTTGTTGGAGCTGAGG - Intronic
947518897 2:230828989-230829011 GCCTGTCCTTGCTGCCCCAAGGG + Intergenic
947742960 2:232493185-232493207 GCCTGTCCAGGTTGGAGCTGGGG - Intergenic
948554433 2:238797621-238797643 GCTTGTTCTCTCTGGAGCTAGGG + Intergenic
948633047 2:239314117-239314139 GCCTGTGTTTGCAGGTGCTAGGG - Intronic
1169577043 20:6975307-6975329 GCCTGTACTTCATGGACCTATGG + Intergenic
1170583288 20:17715092-17715114 GCTGGTCATTGGTGGAGCTAAGG + Intronic
1171322762 20:24260844-24260866 ACCTGCCCTTCCTGGAGCAAAGG + Intergenic
1173144083 20:40510042-40510064 CCCTTTCCTTGCTGCTGCTAAGG - Intergenic
1173617598 20:44413170-44413192 GCCTGGCCTTGCTGATGCTGAGG + Intronic
1174837025 20:53866178-53866200 GCCTGTCCTTTCTGTGGCTGGGG - Intergenic
1178342683 21:31799829-31799851 GCCTGCTCTTGCTTGAGCTCAGG + Intergenic
1180895822 22:19331403-19331425 CCCTGCCCTTGCTGCAGCCAGGG + Exonic
1180895825 22:19331408-19331430 GCCTGCCCTGGCTGCAGCAAGGG - Exonic
1181466345 22:23112606-23112628 CCCTGTCCTTGCTGGAGAAGGGG - Intronic
1181485874 22:23231565-23231587 GCCTGTGCTGGCTGGAGCCATGG + Intronic
1182238850 22:28898377-28898399 GCCTGTGCTTCCTGGAGGTCTGG + Intronic
1184937628 22:47736542-47736564 CCCTTTCCCTGCTGGAGTTAGGG + Intergenic
954915646 3:54146899-54146921 GCCTGCCCCTCCTGGAGCTTTGG + Intronic
961339472 3:126208248-126208270 GCTTGTACGTGATGGAGCTAGGG - Intergenic
961573937 3:127819865-127819887 CCCTGTGCTTGCTGGATCTTGGG - Intronic
964846708 3:161052166-161052188 GCCTTTCCATACTGGAGCAAAGG + Intronic
966158737 3:176946199-176946221 GTCTCTCCTTGCTGGCTCTAAGG + Intergenic
966920729 3:184609933-184609955 GCCTGTGCTGGCTGCTGCTAGGG + Intronic
967572936 3:191052344-191052366 GACTGGGCTTGCAGGAGCTATGG - Intergenic
972670232 4:41208128-41208150 GCCTGGCATTACTGGAGGTATGG - Intronic
977157002 4:93586670-93586692 GCCAGTTCATGATGGAGCTAGGG + Intronic
977435034 4:96983991-96984013 GCCTCTCCATGCTGGCACTAAGG - Intergenic
977561871 4:98540990-98541012 GCCTGGTCTTGCTGAAGCTAAGG - Intronic
980526167 4:133993287-133993309 GCCTGTCCTTGGGGGATATATGG + Intergenic
980915344 4:139028273-139028295 GTCTGTCCTGGCTGAAGGTATGG + Intronic
991599352 5:68337055-68337077 GCCTGTGCTTCCTGGGGCAAGGG - Intergenic
994908409 5:105869342-105869364 CTCTGTCCCTGCTGGAGTTATGG + Intergenic
997528403 5:134567870-134567892 CTCTGTCCTGGCTGGAGCCAGGG - Intronic
999285971 5:150394518-150394540 CCCTGACCCTACTGGAGCTAAGG + Intronic
999853226 5:155565256-155565278 GCCTTTCCTTTCTGGAGTTCTGG + Intergenic
1001260235 5:170222250-170222272 GCCTGGCCTTGGTGGAGGAATGG + Intergenic
1001882202 5:175254147-175254169 TCCTGTGCTTGCTGTAGCCAGGG + Intergenic
1002440919 5:179264072-179264094 GCCTGTCCTCGCTGCTGCTGGGG + Intronic
1006182877 6:32164490-32164512 AGCTGACCCTGCTGGAGCTAAGG + Intronic
1007252074 6:40502550-40502572 TCCTGTCCTTCCTGGAACGATGG + Intronic
1007281449 6:40715265-40715287 GCCTGTCATGGCTGGAGTTATGG + Intergenic
1007956051 6:45918782-45918804 GTATTTCCTTGCTGGTGCTAAGG - Intronic
1012945785 6:105464192-105464214 GCCTCTCCTGGCAGGAACTAGGG - Intergenic
1013589157 6:111605775-111605797 GTCTGTCCGTGGTGGATCTAAGG - Exonic
1017820021 6:158042538-158042560 GCCTGCCCCTGCTGGCGCTCAGG + Intronic
1018999532 6:168737272-168737294 GCCTGTTCTTGCGGTAGCTCAGG + Intergenic
1019388728 7:773585-773607 GACTGTCCTTGCTGGACAGAGGG + Intronic
1019705797 7:2496660-2496682 GCCTGGGCTTGCTGGAGGCAAGG - Intergenic
1020051297 7:5083651-5083673 GCTTGTACTTGCTGGGGATATGG + Intergenic
1020071746 7:5231656-5231678 GCCTGGACTCGCTGGAGCAAAGG + Exonic
1021963674 7:25896318-25896340 TCCTATACTTGCTGGAACTATGG - Intergenic
1022217510 7:28278981-28279003 GTCTGTCCTTGTTTGAGTTAGGG - Intergenic
1022879443 7:34570616-34570638 GCCAGTCCTTGGTTGAGCCAAGG - Intergenic
1022978813 7:35583233-35583255 GCCTGTCCTTGCCTTGGCTAAGG - Intergenic
1023964389 7:44955143-44955165 GCCTGTCCTTGCAGCAGCTGTGG + Intergenic
1024111388 7:46150300-46150322 GCCTGTGCTTGCTGGTGCTGGGG + Intergenic
1029437971 7:100573286-100573308 GCCTGTCCTACCTGGGGCTCCGG + Exonic
1029952754 7:104604240-104604262 GCCTGACCCTGCCAGAGCTATGG + Intronic
1034946524 7:155265898-155265920 GCCTGTCCTTGCCGGTGCCCTGG - Intergenic
1040105957 8:43542089-43542111 GCCTGTCCTGGCTGGGTCTCAGG + Intergenic
1046529212 8:115421875-115421897 CCCTGTCCTTGATTGGGCTAAGG - Intronic
1047521539 8:125598884-125598906 GCCTGGCATGGCTGGAGCAAGGG - Intergenic
1049591062 8:143462857-143462879 GCGTGTGCTTGTTGCAGCTAGGG - Intronic
1050027486 9:1350928-1350950 GCCTCTCCTAGCTGGAGGTAAGG + Intergenic
1053873005 9:42513522-42513544 GCCCATCCTTGCTGCAGCTCAGG - Intergenic
1053899747 9:42782398-42782420 GCCCGTCCTTGCTGCAGCTCAGG + Intergenic
1054261899 9:62875195-62875217 GCCCGTCCCTGCTGCAGCTCAGG - Intergenic
1054269325 9:62953230-62953252 GCCCATCCTTGCTGCAGCTCAGG + Intergenic
1060679292 9:125546972-125546994 GGCTGTCCATGCTGGGTCTAGGG + Intronic
1061113582 9:128593162-128593184 GCCTGTCCGTGCAGCAGCTTTGG + Intronic
1061994036 9:134175090-134175112 GCCTGGCCCTGTTGGAGCTTCGG + Intergenic
1062032004 9:134365979-134366001 GCCTGTCTTTGCAGGAGCCGCGG + Intronic
1062566192 9:137164972-137164994 GCCTGACCTTGCTCGTGCTGGGG - Intronic
1192452182 X:71251500-71251522 GTCTGTCCTTCCCAGAGCTAAGG + Intronic
1197129908 X:122993427-122993449 GCCTGTGCTCACAGGAGCTATGG + Intergenic
1198492645 X:137158037-137158059 GCCAGTGGTTGCTGGAGGTACGG + Intergenic
1200124834 X:153808292-153808314 GCCTGTCCTCTCTGGAGGCAGGG + Intronic