ID: 1129342780

View in Genome Browser
Species Human (GRCh38)
Location 15:74897112-74897134
Sequence AGCCTGTCCTTGCTGGAGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342780_1129342783 0 Left 1129342780 15:74897112-74897134 CCTAGCTCCAGCAAGGACAGGCT 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342780_1129342782 -7 Left 1129342780 15:74897112-74897134 CCTAGCTCCAGCAAGGACAGGCT 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1129342782 15:74897128-74897150 ACAGGCTCTTTCTCCCAACACGG 0: 1
1: 0
2: 1
3: 11
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342780 Original CRISPR AGCCTGTCCTTGCTGGAGCT AGG (reversed) Exonic
900782914 1:4629498-4629520 GTCCTGTCCCTGCAGGAGCTCGG + Intergenic
901054792 1:6444062-6444084 CGGCTCTCCTTGCTGGACCTGGG - Intronic
901324119 1:8356830-8356852 CGCCTGTGTTGGCTGGAGCTGGG - Intronic
902834126 1:19035846-19035868 ATTCTGACCTTGCTGGGGCTGGG - Intergenic
902929010 1:19717259-19717281 AGCCAGTCCTCCCTGCAGCTGGG - Intronic
903015266 1:20357634-20357656 TCCCTGTCCTTTTTGGAGCTTGG + Intergenic
903257099 1:22109833-22109855 AGCCAGTCCATGGTAGAGCTGGG + Intergenic
903663689 1:24994214-24994236 AGCCTGGCCTTCCTTGAGCGTGG + Intergenic
904213585 1:28902101-28902123 AGCCTGTTCTCTCTGGATCTAGG + Intronic
905289718 1:36913013-36913035 AGCGGATCCCTGCTGGAGCTGGG - Intronic
906273308 1:44498282-44498304 AGGCTGTGTGTGCTGGAGCTTGG - Intronic
907243500 1:53093281-53093303 AGCCAGGCCTGGCTGGGGCTGGG + Intronic
908532348 1:65045895-65045917 AGCTTGTAATTGGTGGAGCTTGG - Intergenic
910262031 1:85302393-85302415 AGGCTTTCCTTGTTGGAGCCTGG - Intergenic
911242762 1:95483457-95483479 TGCTTTTCCCTGCTGGAGCTGGG + Intergenic
916087890 1:161284470-161284492 AGCCTGGCCATTCAGGAGCTGGG - Exonic
916151945 1:161802121-161802143 AGCCAGTCCTTGCTGTTGCTGGG + Exonic
916709188 1:167387195-167387217 AGCCTGAGGTTTCTGGAGCTGGG + Intronic
917514595 1:175697135-175697157 AGCCTGACTTTGCTGGTCCTAGG - Intronic
918931850 1:190864615-190864637 CCCCTGTTCCTGCTGGAGCTTGG - Intergenic
920015921 1:202908297-202908319 AACCAGTCATTGCTGGGGCTTGG + Intronic
920203696 1:204276356-204276378 AGTGTGTCCTTGTTGGACCTGGG - Intronic
920650652 1:207834795-207834817 ACCTTCTCCTTGCTGGAGTTTGG - Intergenic
920730679 1:208480980-208481002 AGCCTGTCCTTTCTGGAAGCAGG - Intergenic
920914295 1:210247648-210247670 TGTCTGCCCTTTCTGGAGCTGGG + Intergenic
921247652 1:213261586-213261608 AGCCTGTGATTGGTGGAGTTTGG + Exonic
921732708 1:218595502-218595524 AGCCTGTCTTTGCTGGTGTGTGG + Intergenic
922564329 1:226591568-226591590 TGCCTGTTCTTGGTGGAGCGGGG - Intronic
1063431992 10:5999264-5999286 AGACGGTCCTTGCAGGACCTGGG + Intergenic
1063499281 10:6538318-6538340 GGTCTTTCCTTGCTGGACCTCGG + Intronic
1064255326 10:13738458-13738480 AGCCTGTGCTCCCCGGAGCTGGG - Intronic
1064918472 10:20488767-20488789 AGCATGTCCTTGCTCGGGATTGG + Intergenic
1067126223 10:43517900-43517922 AGACTATACATGCTGGAGCTCGG + Intergenic
1067682332 10:48448960-48448982 AGCCAATCCCTGGTGGAGCTGGG + Intronic
1069605758 10:69737672-69737694 AGCCTGCCTTTCTTGGAGCTTGG - Intergenic
1070340749 10:75495862-75495884 GGCCTGTCTTTCCTAGAGCTTGG - Intronic
1070392582 10:75984227-75984249 AGCCTGGCCTTGCAGGACCCAGG - Intronic
1071428622 10:85584433-85584455 AACCTGTCCTACCTGGAGCAGGG + Intergenic
1071835582 10:89414605-89414627 TTCCTGTTCTTGCTGGGGCTGGG + Exonic
1072058038 10:91780225-91780247 TGCCTGTTCTTGCTTCAGCTAGG + Intergenic
1072530119 10:96311084-96311106 AACCTGTCCTTAGTGGTGCTAGG + Intronic
1072690447 10:97569450-97569472 AGCCAGTACCTGGTGGAGCTGGG + Intronic
1073077025 10:100830539-100830561 AGCCGCTGCTTGCTGGGGCTGGG - Intergenic
1074290541 10:112135296-112135318 AGCCGGTCAGTGGTGGAGCTGGG - Intergenic
1077300927 11:1846581-1846603 AGCCAGGCCTTGCTGGGGCTGGG - Intergenic
1077352500 11:2099413-2099435 CTCCTGTCCTGGCTGGTGCTGGG + Intergenic
1077944131 11:6876843-6876865 AACTTGTCCTTCCTGGAGATAGG + Exonic
1080595631 11:33772480-33772502 AGGCTGGCGTTGCTGGAGGTAGG - Intronic
1080648946 11:34207797-34207819 ACCTTGTCCTTTCTCGAGCTAGG + Intronic
1081712552 11:45226696-45226718 TTCCTGTCCCTGCAGGAGCTGGG + Intronic
1082142971 11:48631224-48631246 AGCCAGACTTTGCTGAAGCTTGG + Intergenic
1082570170 11:54728588-54728610 AGCCAGACTTTGCTGAAGCTTGG + Intergenic
1083234461 11:61342790-61342812 GGCCTGTCATTCCTGGAACTGGG + Exonic
1083633456 11:64107727-64107749 ACCCTGCCCTGGCGGGAGCTGGG + Intronic
1084557317 11:69882843-69882865 AGGCTGTCGGGGCTGGAGCTGGG - Intergenic
1084613005 11:70215935-70215957 AGCCTGTCTTTGCTGGTGTGTGG + Intergenic
1086294975 11:85355716-85355738 ATCCAGCCTTTGCTGGAGCTTGG - Intronic
1088898156 11:114093359-114093381 AGCCTGGCCTTTCTGTAGCAGGG - Intronic
1089126791 11:116181857-116181879 AGCCTGTGTTTGCAGGAGCCAGG + Intergenic
1089275738 11:117334868-117334890 GTCCTGTGCTTGCTGGAGATGGG + Intronic
1089442572 11:118529626-118529648 AGCCTGGCATTGCTGGTTCTGGG - Intronic
1089494280 11:118900546-118900568 AGTGTGTCCATGCTGGGGCTGGG - Intronic
1089642593 11:119857590-119857612 AGCCTGTTCTTGCAGAAGCCAGG + Intergenic
1090059752 11:123454005-123454027 ACCCTGGCCTTGCTAGAGGTGGG - Intergenic
1090171678 11:124611325-124611347 AGCGGGTCCTTGCTGGAGGAGGG - Intergenic
1091129446 11:133133327-133133349 AGCTTTTCCTGGCTGGAGATGGG - Intronic
1092924519 12:13261291-13261313 AGCCTGCCTTTGCTGGTGCGTGG + Intergenic
1095393690 12:41739633-41739655 TCTCTGTGCTTGCTGGAGCTGGG + Intergenic
1095983538 12:47985728-47985750 AACCTGGCCTTCCTGGAGCCCGG - Exonic
1096244411 12:49976080-49976102 AGCCTGTCCTCTCTGGACCAAGG - Exonic
1096330737 12:50710270-50710292 GGCCTGTCCTTGCTGTACTTAGG + Intronic
1096454944 12:51777085-51777107 AGCCTGTCAGTTCTGGAGGTGGG + Intronic
1097830404 12:64218335-64218357 AGCCTGTAATTGTGGGAGCTGGG - Intronic
1098456731 12:70682413-70682435 AGCCTGATCTTGCAGGAGCCAGG - Intronic
1099191897 12:79569741-79569763 AGACTGTCATTGCTGGAACTGGG + Intergenic
1099285623 12:80711055-80711077 AGCCTTTCCTTGCTCTGGCTGGG + Intergenic
1100391633 12:94149611-94149633 AGCCTGGCCACGCAGGAGCTGGG + Exonic
1100697368 12:97110262-97110284 AGCCTGCCCTTCATGGATCTGGG - Intergenic
1100876516 12:98967831-98967853 AGCCTGTCTAGGCTGGAGGTTGG + Intronic
1102429064 12:112867579-112867601 AACCTGTTTTTGCTGGTGCTAGG - Intronic
1102555013 12:113721015-113721037 ATTCTGTCCTTGCTGGAAATGGG - Intergenic
1104239213 12:126971197-126971219 AGCTACTCCATGCTGGAGCTGGG - Intergenic
1104518967 12:129455283-129455305 AGCCTGTACATGATGGACCTGGG - Intronic
1104863838 12:131941159-131941181 AGCCGATGCTTGCTGGAGCTTGG + Intronic
1106227569 13:27796531-27796553 TGCCGGTTCTTCCTGGAGCTAGG + Intergenic
1108530348 13:51322346-51322368 AGTCTGCCCAGGCTGGAGCTTGG - Intergenic
1108699410 13:52930974-52930996 ACCCTGTCCTGGCAGGAGCTTGG + Intergenic
1110158080 13:72342494-72342516 AGGCTGGCCTTGCTGGCGCCTGG - Intergenic
1113892550 13:113744016-113744038 GGCCTGCCCCTCCTGGAGCTTGG + Intergenic
1116734416 14:48671034-48671056 AGCCTCTGCTTCCTGGAGGTGGG - Intergenic
1116873244 14:50087688-50087710 AGCCAATTCTTGATGGAGCTAGG + Intronic
1116957959 14:50943712-50943734 AATCTTGCCTTGCTGGAGCTTGG - Intronic
1118713101 14:68538793-68538815 AGCCTGCCCTGGGTGGGGCTGGG + Intronic
1118897486 14:69957222-69957244 AGGCTGTGTTGGCTGGAGCTTGG + Intronic
1119391363 14:74293242-74293264 AGCCTTTCCTTGTCAGAGCTGGG - Exonic
1119536126 14:75403776-75403798 AGCCTGCCCTTCGTGGAGCCTGG - Intergenic
1121021896 14:90585298-90585320 CGCCTGTCACTGCTGCAGCTAGG - Intronic
1122100944 14:99409094-99409116 ACCCTGTCCTTGCTTGACATCGG - Intronic
1122437023 14:101707187-101707209 AGCTGGTCCCTGCTGCAGCTGGG - Intergenic
1122954981 14:105066338-105066360 AGCCTGGCTTGGATGGAGCTTGG - Intergenic
1126405988 15:48323098-48323120 TGCCTGTTCTTCCTGGGGCTTGG + Intergenic
1128301194 15:66567387-66567409 AGCCTGCCCTTGCTGGAGCCTGG - Intergenic
1128691158 15:69725955-69725977 GGGCTGTCCTGTCTGGAGCTAGG - Intergenic
1128695939 15:69762899-69762921 AGGATGTCCTTGCTGGGGATGGG + Intergenic
1128827089 15:70729370-70729392 ACCATGTCTTTGCTGCAGCTTGG + Intronic
1129147214 15:73659463-73659485 TGCGTGTCCTTGTTGGAGTTGGG + Intergenic
1129342780 15:74897112-74897134 AGCCTGTCCTTGCTGGAGCTAGG - Exonic
1129699173 15:77757768-77757790 AGCCAGCCCTTGCTTAAGCTAGG - Intronic
1130081257 15:80735589-80735611 AGCCCGCCCTGGCTGGAGCGAGG - Intronic
1132204668 15:99978121-99978143 ACCCTGGCCTTGCTGGAGAAAGG + Intronic
1133453593 16:5923416-5923438 CCCCTGTCCTTGCTGGAGCTGGG - Intergenic
1134855808 16:17518070-17518092 TTCCTGTCCTTGCTGGGGCTGGG - Intergenic
1136020135 16:27434838-27434860 AGCCAGTGAATGCTGGAGCTGGG + Intronic
1137530634 16:49276782-49276804 AGCCTGTGCATCCTGGAACTGGG - Intergenic
1137669874 16:50272713-50272735 GGCATCTCCTTGCTGGAGCAGGG + Intronic
1138235162 16:55376305-55376327 GGCCTGTCCCTGTTGCAGCTTGG + Intergenic
1138336704 16:56259084-56259106 AGCAAGTCCATGTTGGAGCTGGG + Intronic
1139224420 16:65220336-65220358 GTCCTGTCCTTACTGGAGGTAGG + Intergenic
1141146509 16:81534076-81534098 AGCATCTCCACGCTGGAGCTGGG + Intronic
1141392984 16:83680261-83680283 AGCTCTGCCTTGCTGGAGCTGGG + Intronic
1141516516 16:84548673-84548695 AGCCTGGCCTGGCAGGAGCCTGG + Intronic
1141631392 16:85289974-85289996 AGCGTGTCCTTGCGGGTGATGGG + Intergenic
1141895595 16:86956912-86956934 AGCCTGTAACTCCTGGAGCTTGG + Intergenic
1142446511 16:90142514-90142536 AGCCTGTTGTTTCTGGAGCCTGG + Intergenic
1203139874 16_KI270728v1_random:1755673-1755695 TGCCTGTCCTTTCTGTGGCTGGG - Intergenic
1142568369 17:855607-855629 TGCCTGTACTTGCTGGAGAATGG - Intronic
1142882483 17:2892631-2892653 AGACTGTCAATGCTGCAGCTGGG - Intronic
1143204423 17:5132309-5132331 AGCCAGTCCTTTCTGGGGGTCGG + Intronic
1143414043 17:6733125-6733147 AGCCTGCCTTTGCTGGTGTTTGG + Intergenic
1143848370 17:9790745-9790767 AGCTAGTCATTGCTGGAGCCAGG + Intronic
1144957404 17:19025945-19025967 AGCCTGTCCTGGCTGGGACTGGG + Intronic
1144977752 17:19148571-19148593 AGCCTGTCCTGGCTGGGACTGGG - Intronic
1145760147 17:27421017-27421039 AGCCAGTCCTTTCTGGGGGTCGG + Intergenic
1145996920 17:29110204-29110226 AGCATGTCCTGGCTGGTGCTGGG - Intronic
1146844240 17:36173512-36173534 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1146856545 17:36261447-36261469 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1146864072 17:36326928-36326950 AGCCAGTCCTTTCTGGGGGTCGG + Intronic
1146872455 17:36385358-36385380 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1146879813 17:36436443-36436465 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1146883737 17:36457594-36457616 AGCCAGTCCTTTCTGGGGATTGG - Intergenic
1147066932 17:37927516-37927538 AGCCAGTCCTTTCTGGGGGTCGG + Intronic
1147075339 17:37985982-37986004 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1147078464 17:38007077-38007099 AGCCAGTCCTTTCTGGGGGTCGG + Intronic
1147086864 17:38065528-38065550 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1147094402 17:38131012-38131034 AGCCAGTCCTTTCTGGGGGTCGG + Intergenic
1147102809 17:38189491-38189513 AGCCAGTCCTTTCTGGGGGTCGG - Intergenic
1147690594 17:42312499-42312521 AGCCAGTCCCTGCTGTCGCTGGG + Intergenic
1148146615 17:45369585-45369607 AATCTGTCATTGCTGGAGCTGGG + Intergenic
1149056346 17:52371144-52371166 AATCTGTTCTTGCTAGAGCTGGG + Intergenic
1149456606 17:56793395-56793417 ACCCTGTGTTTGCAGGAGCTAGG + Intronic
1150085741 17:62272575-62272597 AGCCAGTCCTTTCTGGGGGTCGG - Intronic
1150493322 17:65589140-65589162 AGCCTGGCCATCCTGGAGCATGG - Intronic
1151574789 17:74947341-74947363 AGAGGCTCCTTGCTGGAGCTGGG + Exonic
1151798350 17:76362088-76362110 CCACTGTCCTTGCTGAAGCTGGG - Intronic
1151984264 17:77531967-77531989 AAACTGCCCTTGCAGGAGCTTGG + Intergenic
1152747910 17:82049668-82049690 CGCCTGTACCTGCTGGAGCAGGG + Exonic
1156506604 18:37599796-37599818 AGGCTGTGATGGCTGGAGCTGGG - Intergenic
1159117519 18:64132704-64132726 AACCTGACCTCTCTGGAGCTGGG + Intergenic
1160014794 18:75132560-75132582 AGCCAGTCCCAGCTGGAGCGCGG + Intergenic
1160272862 18:77403617-77403639 GCCCTGGCCTTGCTGGAGGTGGG + Intergenic
1161105722 19:2443152-2443174 AGCCTGTCCTGGCTGGTGCCTGG + Intronic
1161302172 19:3548008-3548030 AACCTGTCCCTGCTGGTGGTGGG - Exonic
1161427639 19:4212681-4212703 CGGCTGTCCCTGCTGGAGGTAGG + Exonic
1162936397 19:13983688-13983710 GGCCTGACCTTGCTGGGGGTTGG - Intronic
1163175930 19:15564085-15564107 AGCCTGTCCTGGCTGGGCCTCGG + Intergenic
1163202665 19:15779877-15779899 AGCCTGTCCTGGCTGGGCCTCGG - Intergenic
1163222833 19:15934374-15934396 AGCCTGTCCTGGCTGGGCCTCGG - Exonic
1164081119 19:21862178-21862200 AGCCTGCCTTTGCTGGTGATTGG - Intergenic
1164789098 19:30960847-30960869 AGCTTGTCTTTATTGGAGCTGGG + Intergenic
1164818271 19:31223826-31223848 TGACTGTCCTAGCTGGAGCGGGG + Intergenic
1165104746 19:33462220-33462242 TGCCTGTCCTTGTGAGAGCTTGG - Intronic
1166250557 19:41567247-41567269 ATACTGTCCTTGCTGGACATAGG + Intronic
1166654300 19:44599062-44599084 ACCTTGTCCTGGCTGGGGCTAGG - Intergenic
1167225023 19:48232271-48232293 AGCCTGTCACTGCTGGGGCATGG - Intronic
1167413654 19:49359663-49359685 AGCCAGTGCGTGATGGAGCTGGG - Intronic
925299317 2:2799332-2799354 AGCCTGGCCTGGCCGGTGCTGGG - Intergenic
925990260 2:9249126-9249148 AGCCAGTCTGTGGTGGAGCTAGG + Intronic
926516379 2:13851419-13851441 TTCCTGATCTTGCTGGAGCTGGG - Intergenic
926651114 2:15346751-15346773 AGTCTGTCCTTGATGGACATTGG - Intronic
927172180 2:20379405-20379427 TGCCTGGCTTTGCTGAAGCTTGG + Intergenic
928215485 2:29357750-29357772 AGGCTGACCTTGCAGGAGGTAGG + Intronic
928403796 2:30998733-30998755 AGCTTGTCAATGCTGGAGCTGGG + Intronic
928898936 2:36297132-36297154 GAGCTGACCTTGCTGGAGCTAGG - Intergenic
929451859 2:42043224-42043246 AGCTTGTCCTCCCTGGAGCAAGG - Intergenic
929537894 2:42795431-42795453 TGCCTGTCCTCACTGTAGCTGGG + Intergenic
929927716 2:46229397-46229419 AGCCTTCCCTGGCTGGAGCTGGG + Intergenic
932158153 2:69437184-69437206 AGGCTGTCTGTGCGGGAGCTCGG - Intronic
932781020 2:74558503-74558525 AGCCTGTCCTTTCTCCAGCAAGG - Exonic
933163989 2:79055384-79055406 AGCCTGTCTTTGCTGGTGTGTGG - Intergenic
934512072 2:94953431-94953453 AGACTGCACTTGCTGGACCTGGG + Intergenic
934768879 2:96895551-96895573 GGGCAGTCCTTGCTGGGGCTGGG - Intronic
935812883 2:106817269-106817291 AGCCTGTGCTGCCTGGAGTTGGG - Intronic
936346365 2:111678496-111678518 AGCCTGTCCACGCCGCAGCTTGG + Intergenic
939027771 2:137034189-137034211 AGCCTATCATTGATGGTGCTGGG + Intronic
940088909 2:149894675-149894697 AGCCAGTCATTGGTGGAGCAGGG + Intergenic
942611503 2:177746686-177746708 AGCCTGTCTTTGCTGGGCATAGG - Intronic
947742961 2:232493186-232493208 GGCCTGTCCAGGTTGGAGCTGGG - Intergenic
948852480 2:240715215-240715237 ATCCTCTCCTTGCTGCATCTTGG + Exonic
1169785275 20:9353423-9353445 TGTCTGTCCTTGGTGGAGCCAGG + Intronic
1170759548 20:19237566-19237588 AGCCTGGCCCTGCTGGTGTTTGG - Intronic
1171962605 20:31505522-31505544 TGCCTGTCCTTGCAGGGGTTTGG + Intergenic
1173781988 20:45763670-45763692 AGCCTGTCTTTGCTGGTGTGTGG - Intronic
1174837026 20:53866179-53866201 TGCCTGTCCTTTCTGTGGCTGGG - Intergenic
1175989180 20:62779039-62779061 GGGCTGTCCTGGCTGGGGCTGGG - Intergenic
1176389949 21:6158297-6158319 AGCCTGTGCCTTCTGGGGCTGGG - Intergenic
1178965010 21:37108605-37108627 AGCCTGTCAGTGCTGTGGCTGGG - Intronic
1178972656 21:37194886-37194908 AGCCTGTCCTGGATGGGGCATGG + Intronic
1179724290 21:43333187-43333209 AGCCTGTCCCTGCAGCTGCTCGG - Intergenic
1179733517 21:43379943-43379965 AGCCTGTGCCTTCTGGGGCTGGG + Intergenic
1180895826 22:19331409-19331431 AGCCTGCCCTGGCTGCAGCAAGG - Exonic
1181466347 22:23112607-23112629 GCCCTGTCCTTGCTGGAGAAGGG - Intronic
1181948714 22:26539106-26539128 AGCCAGTTGGTGCTGGAGCTAGG - Intronic
1182085702 22:27559908-27559930 AGCCTGCACATTCTGGAGCTGGG - Intergenic
1182278247 22:29203809-29203831 GGCCTGTCCTTACTGAGGCTGGG - Intergenic
1182576900 22:31278954-31278976 ATCCTGTCCTTCCTGGAGCAAGG + Intronic
1183515261 22:38261847-38261869 AGGGTGTCCTGGCTGGAGCCAGG - Intronic
1184466308 22:44670381-44670403 AGCCAGCCAGTGCTGGAGCTGGG - Intronic
950417562 3:12876863-12876885 AGCCAGCCCTTGCAGAAGCTTGG + Intergenic
950631151 3:14283044-14283066 TTCCTGTCTTTTCTGGAGCTGGG + Intergenic
951332064 3:21380266-21380288 AGCCTGCCCTTGCTGGTGTGTGG + Intergenic
951900768 3:27655570-27655592 AGCCTGGCCTTCCTGGCCCTTGG - Intergenic
953500618 3:43430013-43430035 AGCCTGTCCTCACTGGATTTGGG - Intronic
954826383 3:53377218-53377240 ACCCTGTGTTTGCAGGAGCTAGG - Intergenic
955516033 3:59727280-59727302 AGCATGACCTTGCTGGATTTTGG + Intergenic
961573939 3:127819866-127819888 ACCCTGTGCTTGCTGGATCTTGG - Intronic
964983910 3:162716606-162716628 AGCCTGCCTTTGCTGGAGTGTGG - Intergenic
965626051 3:170685033-170685055 AGCCTGCCTTTGCTGGAGTGTGG + Intronic
965713682 3:171580424-171580446 AGCCTGCCTTTGCTGGAGTGTGG - Intergenic
966337163 3:178881225-178881247 AGCCTGTACTTGCTGTGTCTGGG + Intergenic
966523196 3:180895006-180895028 CTCCTCTCCTTGCTGGGGCTGGG + Intronic
967830335 3:193913128-193913150 AGCCTGTGCTTGGTGGAAATTGG - Intergenic
968137001 3:196226997-196227019 ATCCTGACCTTGCTGGCGCTGGG + Exonic
968515325 4:1013229-1013251 CGGATGTCCTTGCTGGGGCTGGG - Intronic
968565072 4:1307777-1307799 TTCCTGTCCCTCCTGGAGCTGGG - Intronic
969317500 4:6390929-6390951 AGCCTGAACTTGGTGGAGATGGG + Intronic
974019218 4:56678128-56678150 ACCCTATCCTCGCTGGAGCTGGG + Intronic
974394757 4:61320538-61320560 AGCCTTTCCATGTTGCAGCTTGG + Intronic
975390041 4:73805134-73805156 AGCCTGTCCTTGCATGAGATGGG - Intergenic
976813906 4:89124686-89124708 ACCCTGTCCTGGCTGGGGGTGGG - Intergenic
977157001 4:93586669-93586691 AGCCAGTTCATGATGGAGCTAGG + Intronic
978442723 4:108750749-108750771 ACCTTGTACTTGCTGGATCTTGG + Intronic
978501250 4:109412168-109412190 AGCCTTCCCTTTCTGCAGCTTGG - Intergenic
979054353 4:115977368-115977390 AGCCTGCCCTTGCTGGTGTGTGG + Intergenic
982657853 4:158171181-158171203 CGCCTGTCCATGCTGGAGAGAGG + Exonic
985793469 5:1945414-1945436 AGCCTGACCTTCCTGGTGCCTGG + Intergenic
986664239 5:10086305-10086327 AGCATTTCCTTGCTGGATTTGGG - Intergenic
987144708 5:14980999-14981021 AGCCTGTCAGAGCTGGTGCTGGG - Intergenic
988847239 5:35140615-35140637 ATCCTGTCCTTGATGGACTTAGG + Intronic
989109387 5:37892559-37892581 AGCCTGTCCTTCCTGTCTCTTGG + Intergenic
992610761 5:78506496-78506518 AGCAAGTCCTTGCTGAGGCTGGG + Intronic
993709743 5:91213077-91213099 ATCTAGTCTTTGCTGGAGCTAGG + Intergenic
994691709 5:103027541-103027563 AGTCTGTCCTTTATGGAGATAGG + Intronic
995745837 5:115402379-115402401 AGGGTGTGCTTGCTGGAGCCTGG - Intergenic
996917931 5:128733340-128733362 AGCCTGTCTTTGCTGGTGAGTGG - Intronic
997603354 5:135155562-135155584 AGCCTATCCTGGCCTGAGCTAGG + Intronic
997761479 5:136452407-136452429 ACCCTTTCTTTTCTGGAGCTGGG - Intergenic
999394553 5:151219029-151219051 AGCCTGTACTGGCTTTAGCTAGG + Intronic
999432476 5:151536316-151536338 TGCCTGTCCCTGCTGGGGTTAGG + Intronic
999468002 5:151825267-151825289 AATCTCCCCTTGCTGGAGCTGGG + Intronic
999735447 5:154509669-154509691 AGACTTTCCTTGCTGCAACTAGG + Intergenic
1001082549 5:168677834-168677856 ACTCTGGGCTTGCTGGAGCTGGG + Intronic
1001882201 5:175254146-175254168 ATCCTGTGCTTGCTGTAGCCAGG + Intergenic
1002297571 5:178240031-178240053 AGCCTGTGCTGGCTGGAGCAGGG + Intronic
1002440918 5:179264071-179264093 GGCCTGTCCTCGCTGCTGCTGGG + Intronic
1003422251 6:5969035-5969057 AGCCTGGCCTTGGTCCAGCTCGG + Intergenic
1005364880 6:25066831-25066853 AGGCTGTTCTTGCTGCAGCTGGG + Intergenic
1006829601 6:36960844-36960866 AGCCTTGCCTTGCTGGTTCTAGG - Intronic
1007294938 6:40814503-40814525 AGCCTTTCCTTCATGGAGGTTGG - Intergenic
1008159835 6:48063547-48063569 AGCTAGTACTTGCTGGAGCTTGG - Intronic
1009899004 6:69788882-69788904 AGCCTGTAAGTGCTGAAGCTGGG - Intronic
1013311379 6:108897590-108897612 AGCCTGGACTTGCTGCAACTGGG + Intronic
1013652093 6:112205809-112205831 AGCCTCTCCTCCCTGGAGGTTGG - Intronic
1014806492 6:125835740-125835762 AAGATGTCCTTCCTGGAGCTAGG + Intronic
1015719961 6:136230671-136230693 AGCCACTCCTAGCTGGGGCTAGG + Intergenic
1016389605 6:143561562-143561584 AGTCAGTCCTCCCTGGAGCTGGG + Intronic
1017254886 6:152322780-152322802 AGCCTGAGCGGGCTGGAGCTAGG - Intronic
1017499955 6:155015046-155015068 AGGGTGTGCATGCTGGAGCTGGG + Intronic
1017764239 6:157593654-157593676 AGCCTGTCCTGGCGGAAGTTGGG - Intronic
1019526131 7:1481277-1481299 AGCCTGGCCGGGCTGGGGCTCGG + Intronic
1023869943 7:44257742-44257764 AGACTGTCCCTGCAGGGGCTTGG - Intronic
1024111387 7:46150299-46150321 TGCCTGTGCTTGCTGGTGCTGGG + Intergenic
1026302410 7:69109328-69109350 AGCCTGTCCTTATGGGATCTTGG - Intergenic
1033264983 7:139877154-139877176 AGCCTGACATTGATGGAGCAGGG + Intronic
1034200788 7:149281870-149281892 AGCCAGGCCATGCTGGAGCCGGG + Exonic
1035549013 8:505928-505950 ACCCTGTCCTGGCTGGCACTGGG - Intronic
1038627604 8:29209262-29209284 AGCCTGTTCTTTCTGTAGCCTGG - Intronic
1039896819 8:41722672-41722694 TGCCTGTCTTTTCTGGAGCTAGG + Intronic
1040629445 8:49193102-49193124 AGGCTGTCCTGGCCAGAGCTGGG - Intergenic
1043782027 8:84348067-84348089 AGCCTGTGATGGCTGGAGTTTGG + Intronic
1047607412 8:126488821-126488843 TGTCTGTCCATGCGGGAGCTGGG + Intergenic
1048270877 8:133027045-133027067 AGGCTGTACCTGGTGGAGCTGGG + Intronic
1048447898 8:134505648-134505670 AGCCTGCCGTTGCTGGCTCTGGG + Intronic
1048601699 8:135925148-135925170 AGACTGTCTGTGCTGAAGCTCGG + Intergenic
1049280182 8:141740181-141740203 AGCCTGGGCTTGCTGGTTCTAGG + Intergenic
1049531592 8:143158164-143158186 AGCCTGGCGTGGCTGGGGCTGGG - Exonic
1050195354 9:3077506-3077528 AGCCAGTCCTACCTGGTGCTGGG + Intergenic
1051265692 9:15306903-15306925 GGTCTGTCCCCGCTGGAGCTAGG - Intronic
1052246845 9:26346804-26346826 AGACTGTCCCTGCAGGACCTGGG - Intergenic
1053381705 9:37654343-37654365 AGCCAGTCTTGCCTGGAGCTGGG + Intronic
1054807181 9:69406242-69406264 AGCCTGCCTTTGCTGGTGTTTGG + Intergenic
1058928217 9:109689786-109689808 AGCCTGTCTCTGGAGGAGCTGGG + Intronic
1061397670 9:130352433-130352455 AGCCTTTCCTTGCTGTAACCCGG + Intronic
1062566193 9:137164973-137164995 GGCCTGACCTTGCTCGTGCTGGG - Intronic
1187353684 X:18546055-18546077 AGCCTTTCCTTTCTGGAGTGTGG - Intronic
1188812166 X:34664027-34664049 AGCTTATTCTTGCTGGAGCTTGG + Intergenic
1188934743 X:36160372-36160394 AGCCTGTCATTGGTGGTTCTGGG + Intergenic
1190448792 X:50557387-50557409 AGACTGCTCTTGCAGGAGCTGGG + Intergenic
1192051866 X:67731862-67731884 AATCTGCCCTTGCTGGACCTCGG + Intergenic
1195571462 X:106402368-106402390 AGCCACTTCTTGCTGCAGCTGGG + Intergenic
1197522238 X:127512918-127512940 ATCCTGTCTCTTCTGGAGCTGGG + Intergenic