ID: 1129342781

View in Genome Browser
Species Human (GRCh38)
Location 15:74897119-74897141
Sequence GAGAAAGAGCCTGTCCTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342781_1129342783 -7 Left 1129342781 15:74897119-74897141 CCAGCAAGGACAGGCTCTTTCTC 0: 1
1: 0
2: 5
3: 33
4: 304
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342781 Original CRISPR GAGAAAGAGCCTGTCCTTGC TGG (reversed) Exonic
901661227 1:10799138-10799160 GAGACAAAGCCTGCCCTTGAGGG + Intergenic
902624218 1:17667329-17667351 GAGACACAGCCTGCCCTTGGAGG + Intronic
902837501 1:19056653-19056675 GAGAAAGAGGCTGGGCTTGGTGG + Intergenic
903145610 1:21370182-21370204 GAGCAAGACCCTGTCCTTAAGGG + Intergenic
903218878 1:21857879-21857901 GAGAAGGGGCCTGTCCTTCAGGG - Intronic
903233407 1:21935398-21935420 CAGACAGGGCCTGTCCTTGCTGG + Intronic
904373133 1:30063330-30063352 CAGAGAGAGCCTGGCCTTGCTGG - Intergenic
905316726 1:37086701-37086723 GAGGTAGAGCCTCTCCATGCTGG + Intergenic
905470623 1:38188982-38189004 GAGATAGAGGCTCTCCCTGCTGG - Intergenic
905627275 1:39497569-39497591 TGGAAAGAGCCTGTCCCTGTGGG - Intronic
906696692 1:47828057-47828079 GACAATGAGCCCTTCCTTGCAGG + Intronic
907386295 1:54127701-54127723 ATGAAAGAGCCTGTCATGGCTGG - Intergenic
907519663 1:55014956-55014978 AAGAAGGAGACTGTCCTGGCTGG + Intergenic
907633320 1:56106720-56106742 GAGAGTGAGACTGGCCTTGCTGG + Intergenic
907947762 1:59151338-59151360 GGGAGAGAGCCTGTGCCTGCTGG - Intergenic
909309614 1:74129807-74129829 GAGAAAGACCCAGTCCTGGAAGG - Intronic
911241388 1:95471134-95471156 GAGAAGGACCCAGTCCTGGCAGG - Intergenic
915042752 1:152982573-152982595 CAGAAAGAGCCTTGCCTTGTGGG - Intergenic
915044063 1:152996802-152996824 GAGGAAGGGACTCTCCTTGCAGG - Intergenic
916661519 1:166926250-166926272 GATAATGAGCCTGTCCATGTGGG + Intronic
917509302 1:175657083-175657105 GGGGAAGAGCCTGTCCTTTAGGG + Intronic
918093969 1:181319286-181319308 CAGAAACATCCTTTCCTTGCAGG - Intergenic
921774585 1:219082212-219082234 GGGAAAGACCCTGTACTTGCAGG - Intergenic
922203207 1:223424311-223424333 GAAAATGAGCCTGTCCTTCCTGG - Intergenic
922333089 1:224594823-224594845 TAGAGAGAGACTGCCCTTGCAGG - Intronic
922433133 1:225575782-225575804 GAGACAGTGCCAGTCCTTCCTGG - Intronic
922642242 1:227245737-227245759 GAGAAGGATCCAGTCCTGGCAGG + Intronic
922703450 1:227775863-227775885 GAGACAGAGACTTTCCTAGCAGG + Intronic
923041654 1:230324000-230324022 GAGGAAGAGCTTGGCCTTGGGGG - Intronic
923331194 1:232926432-232926454 GAGAAAGAGTCTGGTCTGGCCGG + Intergenic
923509144 1:234634366-234634388 CAGAAAGAGCCTGACCCTGGCGG + Intergenic
923514502 1:234683281-234683303 GAGCAAGACCCTGTCTTTGCTGG + Intergenic
924490836 1:244535982-244536004 GAGAAGGACCCAGTCCTGGCAGG - Intronic
924708830 1:246518382-246518404 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1063298241 10:4827053-4827075 GGGACAGAGCCAGACCTTGCTGG + Intronic
1063870417 10:10410727-10410749 GAGAAAAAGACTGACCTTCCTGG + Intergenic
1067027628 10:42858264-42858286 GAAAAAGAGCCTGTTCTCTCTGG - Intergenic
1067127813 10:43535068-43535090 GAGAAAGAGACTGTCATCTCAGG - Intergenic
1069778368 10:70939903-70939925 GAGCAGCAGCCTGTCCTTGCAGG + Intergenic
1071288913 10:84174040-84174062 GAGAAAGAGCCCATCTTTCCGGG - Intronic
1071469801 10:85975767-85975789 GAGAGAGAGCTTGACCTTGAGGG - Intronic
1071493514 10:86152570-86152592 GAGAAAGAGCCTGGGCTTTGGGG + Intronic
1072069339 10:91901203-91901225 CAGAGAGAGCATGGCCTTGCTGG - Intergenic
1073462225 10:103672462-103672484 GAGAAACGGACTGTCCTTCCTGG + Intronic
1073938590 10:108665548-108665570 CAGAAACAGCCTGTCCATGAGGG - Intergenic
1074695339 10:116045496-116045518 GACAAACTGCCTCTCCTTGCAGG + Intergenic
1074760974 10:116667281-116667303 CAGAAAGAGCATGGCCCTGCGGG + Intronic
1074882995 10:117672973-117672995 GAAACAGATCCTGTCCTGGCTGG - Intergenic
1075194956 10:120348348-120348370 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1075745058 10:124721294-124721316 GAGTAAGAGTCTGTCCAGGCAGG - Intronic
1076376796 10:129993741-129993763 GGGAAGGACCCTGTCCTGGCAGG + Intergenic
1077162707 11:1121029-1121051 GGGACAGAGCATGTCCTTGAGGG + Intergenic
1077832661 11:5891737-5891759 GAGAAAGAGAATGCCCGTGCAGG - Intronic
1078604865 11:12766169-12766191 GGGAAAGGTCCTGTCCTTTCAGG + Intronic
1079245766 11:18751126-18751148 GAGGAACAGCCTGGCCTTGCTGG + Intronic
1079416202 11:20238603-20238625 GAGAAAGACCCAGTCCTGGCAGG - Intergenic
1081212710 11:40355646-40355668 GAGAGAGAATCTGTGCTTGCGGG - Intronic
1081812050 11:45919615-45919637 GAGAAGGAGCCTCACCTTGAGGG - Intergenic
1084763881 11:71294902-71294924 GAGAAGGACCCAGTCCTGGCAGG - Intergenic
1085120627 11:73965263-73965285 GGGAAAGAGCCTGTCCCAGTTGG - Intronic
1085178414 11:74511039-74511061 GAGAAGGACCCAGTCCTGGCAGG + Intronic
1087498104 11:98916702-98916724 GAGAAAGACCCAGGCCTGGCAGG - Intergenic
1087709607 11:101533630-101533652 CAGAAAGAGCCTGACCATACTGG + Intronic
1088117353 11:106327513-106327535 GAGAAAGACCCTGTCTTTGGGGG - Intergenic
1088583571 11:111337667-111337689 GAGAAACTGACTTTCCTTGCAGG - Intergenic
1089708587 11:120298879-120298901 GAGAAAGAGCCACCCCTTTCTGG + Intronic
1089853850 11:121523410-121523432 GAGATGAAGCCTGTCCTTGCTGG + Intronic
1090568204 11:128018956-128018978 GAGAAAGAGCCTGAGCATGGTGG - Intergenic
1091949502 12:4581151-4581173 GTGAGAGAGCCTGTGCTTGCTGG + Intronic
1092447862 12:8574435-8574457 GAGACAGAGCCCGTCCAGGCTGG + Intergenic
1096088303 12:48881278-48881300 GTGATAGAGTTTGTCCTTGCAGG - Intergenic
1096177833 12:49534820-49534842 GAAGCAGAGCCTGGCCTTGCTGG + Intergenic
1098037351 12:66317816-66317838 GGGAATGAGGCTGTTCTTGCTGG - Intronic
1098160018 12:67640916-67640938 GATAAATAGCCTGTCCTCACTGG + Intergenic
1098456732 12:70682420-70682442 GAGACAAAGCCTGATCTTGCAGG - Intronic
1098674565 12:73272670-73272692 GAACAAGATCATGTCCTTGCAGG + Intergenic
1098856971 12:75664035-75664057 GAGAATGAGGCTGTTCTTACAGG - Intergenic
1098983542 12:76985414-76985436 GGGATAGAGCCTGTATTTGCAGG + Intergenic
1099024480 12:77448166-77448188 GAGAAGGACCCAGTCCTAGCAGG + Intergenic
1099781647 12:87202835-87202857 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1099991818 12:89730507-89730529 CTGAAATAGCCTGGCCTTGCTGG - Intergenic
1100825165 12:98468128-98468150 GAGAAAGAAGCTGTGCTGGCTGG + Intergenic
1102484598 12:113247263-113247285 GAGAATGAGCCCCTGCTTGCTGG - Intronic
1104035861 12:125096773-125096795 GAGCAAGTGCCTGCCCTTCCTGG - Intronic
1106830074 13:33571558-33571580 GGGAAAGAGTGTGGCCTTGCTGG - Intergenic
1108498205 13:51045359-51045381 GAGAAGCTGCCTGTCCCTGCGGG + Intergenic
1109726382 13:66346728-66346750 GAGAAAGAGCCAGTGCTCTCTGG - Intronic
1110829794 13:80017993-80018015 GACATAAAGGCTGTCCTTGCTGG - Intergenic
1112808381 13:103187860-103187882 GAGAAAGAGCTTCCCCTTTCTGG - Intergenic
1112901528 13:104363279-104363301 GAGAAAGATCCAGCCCTGGCAGG - Intergenic
1113157450 13:107339722-107339744 GAGAAATGGCCTGTCATTACTGG - Intronic
1113923824 13:113929434-113929456 GAAGCTGAGCCTGTCCTTGCTGG - Intergenic
1117548792 14:56813399-56813421 GATAAAGAGCATGTTCTTACAGG - Intergenic
1118910993 14:70061947-70061969 GACAAAGAGCCAGTCTTTGGAGG - Intronic
1119201662 14:72757227-72757249 GAGAGAGAGCCTTTCCCTGGGGG - Intronic
1119630708 14:76229553-76229575 GAGAACGAGCCTCTGCTTCCAGG - Intronic
1121559206 14:94862053-94862075 GTGAAAGAGCCTGTTTTTGTTGG - Intergenic
1122792726 14:104191180-104191202 GAGCCACAGCCTGGCCTTGCAGG + Intergenic
1123048093 14:105528116-105528138 GAGACCGAGCCTGCCCGTGCAGG + Intronic
1125419230 15:39487479-39487501 GAGTAAGAGACTGTCCTAGATGG - Intergenic
1125567190 15:40685662-40685684 GAGAAGGACCCAGTCCTGGCAGG - Intergenic
1125762103 15:42103854-42103876 GAGAAAGCCCCTGTACTTCCAGG + Intergenic
1125871534 15:43106359-43106381 AAGCAAGAACCTGTCCTAGCTGG + Intronic
1127394209 15:58530395-58530417 CAGAAACAGCCTGTCCTCTCAGG + Intronic
1129230882 15:74196667-74196689 CAGAAAGAGCTTGCCCTGGCTGG - Intronic
1129342781 15:74897119-74897141 GAGAAAGAGCCTGTCCTTGCTGG - Exonic
1130037252 15:80372114-80372136 GAGAAAGGGCCTGGCATTCCTGG + Intronic
1134780360 16:16889747-16889769 CAGAGAGAGCCTAGCCTTGCTGG - Intergenic
1134847772 16:17455142-17455164 GATAGAGACCCTATCCTTGCAGG + Intronic
1135485491 16:22861387-22861409 TAGACAGAACCTGTACTTGCTGG + Intronic
1137637124 16:49996305-49996327 GACAAAGAGGCTCTCCTGGCTGG - Intergenic
1137661945 16:50215045-50215067 GAGAAAGATCTTGGCCTTTCAGG + Intronic
1138609476 16:58111271-58111293 GTGACAGAGCCTGCTCTTGCAGG - Intergenic
1139384850 16:66560201-66560223 GAGAAAGAGCATGACCCTCCAGG + Intronic
1139503801 16:67388908-67388930 TAGAAAGAGCCTGGCCTGGGAGG + Intergenic
1139513985 16:67442724-67442746 GCTCAAGTGCCTGTCCTTGCTGG + Intronic
1141516515 16:84548666-84548688 CACAAAGAGCCTGGCCTGGCAGG + Intronic
1141624172 16:85252799-85252821 CAGGACGGGCCTGTCCTTGCAGG + Intergenic
1141689147 16:85586735-85586757 GAGAAAGAGGCCCTCCATGCCGG - Intergenic
1141893255 16:86942104-86942126 GAGACAGTGCCTGTCCCTTCAGG + Intergenic
1142569601 17:864520-864542 GAGAAACAGCCTGTACTCCCAGG - Intronic
1143204419 17:5132302-5132324 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1143752842 17:9042924-9042946 GAGAAATAGCTGGTCCTTGAAGG + Intronic
1144957401 17:19025938-19025960 GAGGCAGAGCCTGTCCTGGCTGG + Intronic
1144977755 17:19148578-19148600 GAGGCAGAGCCTGTCCTGGCTGG - Intronic
1145760143 17:27421010-27421032 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1145798910 17:27671316-27671338 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1145988127 17:29061215-29061237 GAGAAAGAGGCTGGCCTGGTTGG + Intergenic
1146160163 17:30555297-30555319 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1146749895 17:35368919-35368941 GGGAAAGACCCAGTCCTGGCAGG + Intronic
1146844244 17:36173519-36173541 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146856549 17:36261454-36261476 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146864068 17:36326921-36326943 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1146872459 17:36385365-36385387 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146879817 17:36436450-36436472 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1146883740 17:36457601-36457623 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1147066928 17:37927509-37927531 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1147075343 17:37985989-37986011 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1147078460 17:38007070-38007092 GGGACAGAGCCAGTCCTTTCTGG + Intronic
1147086868 17:38065535-38065557 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1147094398 17:38131005-38131027 GGGACAGAGCCAGTCCTTTCTGG + Intergenic
1147102813 17:38189498-38189520 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1148335251 17:46836682-46836704 GAGAAAGTGACTGGCCTTCCTGG + Intronic
1149239768 17:54635476-54635498 GGGAAAGACCCAGTCCTGGCAGG + Intergenic
1149485046 17:57036136-57036158 GAGAAAGAGCCTGTTCTCCAGGG + Intergenic
1149511848 17:57248718-57248740 GAAAATGTGCCTGTCTTTGCAGG + Intergenic
1149847387 17:60015965-60015987 GGGACAGAGCCAGTCCTTTCTGG - Intergenic
1150085745 17:62272582-62272604 GGGACAGAGCCAGTCCTTTCTGG - Intronic
1151380040 17:73719592-73719614 GAGAAAATGCCTGTCCTTGCAGG + Intergenic
1152690499 17:81715762-81715784 AAGAAAGCCCCTGGCCTTGCAGG - Intronic
1152859200 17:82685678-82685700 GAGAACGAAACTGTCCTTTCGGG + Intronic
1153027970 18:688408-688430 GAGAAAGAGCCTGGCCTAAGGGG + Intronic
1153465428 18:5382649-5382671 GAGAAAGAGCCTCTCCTAGGTGG - Intergenic
1153954409 18:10083852-10083874 CTGAAAGAGCCAGTCCTTGAAGG - Intergenic
1155569496 18:27176148-27176170 GTGGAGGAGGCTGTCCTTGCTGG + Intronic
1156020869 18:32597944-32597966 GAGAATGAGACTGGCCTTGCTGG + Intergenic
1156094226 18:33510193-33510215 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1157664334 18:49473133-49473155 GAGAAAGTGCCTGTACTTCAAGG - Intergenic
1158436122 18:57436376-57436398 GAGCCAGAGCCTGTCCCCGCTGG + Exonic
1163599707 19:18241561-18241583 GAGAAAGACCCTGTCTTGGCCGG - Intronic
1163636430 19:18438982-18439004 GAGACAGGGCCTGACCTTGGAGG + Intergenic
1164672370 19:30079729-30079751 TAGAAAGAGCCCATCCTTGCAGG - Intergenic
1164913131 19:32028166-32028188 GAGAAGGAGCCTGTCATGGATGG - Intergenic
1166080090 19:40438575-40438597 GAGAATAAGTCAGTCCTTGCAGG + Intergenic
1166190413 19:41173020-41173042 GAGTAAGTGCCTGCCCTGGCCGG - Intergenic
1166745833 19:45141483-45141505 GAGAAAGTGCCTCCCCGTGCTGG - Intronic
1167110859 19:47460165-47460187 GAGACACAGCCTGTCCATGAGGG - Intronic
1167332960 19:48867718-48867740 GAGAAAGAGCCTGTTGTTTCGGG + Intronic
925020039 2:561775-561797 GAAAAAGAGACTGTCAATGCAGG - Intergenic
925506362 2:4569314-4569336 GGGAAAGACCCAGTCCTGGCAGG - Intergenic
925662577 2:6218583-6218605 GAGAAATAGCTTGTTCTAGCTGG + Intergenic
925824824 2:7837432-7837454 GAGCAAGTGCCTGTCCTCGAGGG - Intergenic
926511460 2:13785435-13785457 CAGAAAGTGACTTTCCTTGCAGG + Intergenic
926518899 2:13884412-13884434 GGGAAAGATCCAGTCCTAGCAGG + Intergenic
927444063 2:23142248-23142270 GGGAAATTGCCTGTCCTTCCAGG - Intergenic
928420657 2:31136023-31136045 GAGAAAGTTCATGTCCCTGCAGG + Intronic
928683900 2:33728374-33728396 GAGAGAGAGTCGGGCCTTGCTGG - Intergenic
932226588 2:70046003-70046025 GTGAAAGAGGCTGTGCTTGCAGG - Intergenic
935960630 2:108422483-108422505 GAGACAGAGCCTGACTGTGCTGG - Intergenic
937305033 2:120865862-120865884 GAGAGAGAGCCTGGCCTGCCTGG - Intronic
938011341 2:127831429-127831451 GAGAAAGAGCAAGCTCTTGCCGG + Intergenic
938951045 2:136254758-136254780 GAGAAAGAACCTGTAGCTGCAGG - Intergenic
941448368 2:165628998-165629020 GATAAAGAGCCTGTACTACCTGG - Intronic
945771250 2:214045315-214045337 GGGAAAGACCCAGTCCTGGCAGG + Intronic
946885479 2:224218211-224218233 GAGAACAAGCCTGGCCTAGCTGG - Intergenic
947324262 2:228957465-228957487 GAGAAAGAGCATCTTCCTGCAGG - Intronic
947728941 2:232417663-232417685 GAGACAGCGTCTGTCCTTGAGGG + Intergenic
948046608 2:234950996-234951018 GAGAAAGCGCGGGTCTTTGCCGG - Intergenic
948222584 2:236284454-236284476 CTGAAAGAGCCAGTCCTAGCTGG - Intergenic
948253193 2:236546904-236546926 GAGAAAGGGGCTGGCCTTGGAGG + Intergenic
948991329 2:241555967-241555989 GGGGAAGAGCCTGTACTTGCAGG - Intergenic
1168784533 20:526594-526616 GAGAAAGACCCTGCCTCTGCAGG + Intronic
1172884688 20:38223142-38223164 GAGAAGGAGCCTGCCTTTGTGGG - Intronic
1173184623 20:40831068-40831090 GCGACAGAGGCTGTCCTTGAAGG - Intergenic
1173295005 20:41748391-41748413 GTGAAAAAGCCAGTCCTTCCTGG + Intergenic
1173806307 20:45927627-45927649 GAGAGGGAACCTGTCCTAGCCGG + Intergenic
1175143064 20:56874720-56874742 GAGAGAGAGCCGGTGCATGCTGG + Intergenic
1178170912 21:30039089-30039111 GAAACAGAGCCCGTTCTTGCTGG + Intergenic
1182174301 22:28268015-28268037 AATAAAGAGCCTGTTCTTGATGG - Intronic
1182947206 22:34334575-34334597 AGGAAGGAGCCTGTCTTTGCTGG - Intergenic
1183900620 22:41003199-41003221 CAGAAAGAACCTGTACTTCCGGG - Intergenic
949711889 3:6880420-6880442 GAGAAAGAGAATGTCATTCCAGG - Intronic
950184444 3:10936588-10936610 GAGAAAGAGACTTTCCTTTGTGG - Intronic
950611036 3:14126638-14126660 GAAAACAAGCCTGTCCTTGCAGG + Intronic
950682071 3:14592382-14592404 GACACAGAGCCTGTCCATGCAGG - Intergenic
950878707 3:16303479-16303501 GAGAAAAAGTCTGTCATTGGAGG - Exonic
953363928 3:42325564-42325586 GAGAAAGAATCTGTCCTGTCTGG - Intergenic
954327313 3:49870520-49870542 GGGAAAGACTCTGGCCTTGCAGG - Intergenic
954434868 3:50490595-50490617 GGGACAGAGCCTGGCTTTGCTGG - Intronic
954611676 3:51947616-51947638 GAGAGTGAGCCTTTTCTTGCTGG + Intronic
956007894 3:64799865-64799887 CAGAAAGAACATGTCCTTGCCGG + Intergenic
956652202 3:71514477-71514499 GACAAAGATCCTGGCCTTGTGGG - Intronic
957560580 3:81815636-81815658 GAGAAAGAGATTCTCCTTGCTGG - Intergenic
958775969 3:98483293-98483315 GGGATTGAGACTGTCCTTGCTGG - Intergenic
961192636 3:124974946-124974968 GGGAAGGAGCCTGTGCCTGCTGG - Intronic
961345944 3:126263493-126263515 GAGAAAGAGGCAGACCTTCCTGG + Intergenic
961386187 3:126524600-126524622 GAGCAAGAGCCTTTGCTCGCGGG - Intronic
961816667 3:129554536-129554558 GAGGAACAGCCTGTACTTGTGGG + Intergenic
963573870 3:147033892-147033914 GAGATAGAACCAGTCCTGGCAGG + Intergenic
964324965 3:155535451-155535473 GGGAATGAGACTGGCCTTGCTGG + Intronic
964686740 3:159404053-159404075 GAGAAGAACCCAGTCCTTGCAGG + Intronic
965099540 3:164278389-164278411 GAGAAAGACCCAGTCCTGGCAGG + Intergenic
965742412 3:171889928-171889950 GGGAAGGACCCAGTCCTTGCAGG - Intronic
966546387 3:181153975-181153997 GAGAAACAGCATGACCTTACAGG - Intergenic
967288810 3:187899354-187899376 GAGAAAGAGCCTGTCACTAGTGG + Intergenic
968619295 4:1596624-1596646 GTGAAAGAGCCAGTCCCTGAAGG - Intergenic
968736729 4:2301163-2301185 GAGACATAGCCTGTCCTCCCAGG - Intronic
969099511 4:4758234-4758256 GAGAAAAAGCCTGGCCTCCCAGG - Intergenic
969399600 4:6945186-6945208 GAGAAATGGCCTGTATTTGCTGG + Intronic
969527087 4:7709310-7709332 GTGAATGAGCCTGTCTCTGCAGG + Intronic
969826282 4:9761116-9761138 CAGAAAGAGGCTGGGCTTGCAGG + Intergenic
970963327 4:21898562-21898584 TGGAAAGAGCCAGTCCTGGCAGG + Intronic
971324895 4:25635664-25635686 GAAAAAGAGTCTCACCTTGCAGG + Intergenic
974404128 4:61444045-61444067 GACAAAGGGACTGTCTTTGCTGG + Intronic
976517476 4:85985310-85985332 GAACAAGAGCATGTCTTTGCAGG + Intronic
977325722 4:95572533-95572555 AAGAAGGACCCAGTCCTTGCAGG - Intergenic
978407304 4:108394187-108394209 GAGCTAGAGACTGTCCTTGTGGG + Intergenic
979396708 4:120197805-120197827 GAGAAAGACCTGGTCCTGGCAGG + Intergenic
980227000 4:129999240-129999262 GAGAAAGACTCAGTCCTGGCAGG + Intergenic
981246889 4:142551148-142551170 GAGAAAGAATGTGTGCTTGCTGG - Intronic
981518382 4:145634777-145634799 GAAAAGGAGCCAGTCCTGGCAGG - Intronic
982828331 4:160027718-160027740 GAGAAGGACCCAGTCCTGGCAGG - Intergenic
985100759 4:186456073-186456095 GAGTAAGAGCCTGTCTTTGGGGG + Intronic
985134435 4:186771448-186771470 GAGGAAGAGGATGTCCTTGGTGG - Intergenic
985790365 5:1923720-1923742 GACAAAGACCCTGTCCTTGCAGG + Intergenic
985863437 5:2492826-2492848 GAGAAAGGCTCTGTCTTTGCAGG - Intergenic
988865667 5:35331707-35331729 GAGAGAGAGCATGGCCCTGCTGG + Intergenic
991392486 5:66161853-66161875 GAGAAACAGCCTGTCTTTTAGGG + Intronic
993981233 5:94545635-94545657 GAGAAGGACCCAGTCCTGGCAGG + Intronic
999178115 5:149646520-149646542 GCGAAAGAGGCTTTTCTTGCTGG + Intergenic
1000188609 5:158886013-158886035 GGAAAGGAGCCTGGCCTTGCTGG + Intronic
1000628435 5:163565608-163565630 GAGTAATTGCCTGGCCTTGCGGG + Intergenic
1002088500 5:176790959-176790981 CAGGAAGAGCCTGGCCTGGCGGG - Intergenic
1002094699 5:176824006-176824028 GAGAAAGCACCTGTCCCAGCTGG + Intronic
1003081678 6:3026392-3026414 GAGAAAGAATCTGCCCTTGTGGG + Intergenic
1006896681 6:37475687-37475709 GAGCAAGAGGGTGACCTTGCGGG + Intronic
1007199738 6:40097006-40097028 GAGAAAGAGCCTGTAATACCAGG + Intergenic
1007699823 6:43759932-43759954 GAGAAAGACCCTTTCCTGGTGGG - Intergenic
1008061048 6:46997256-46997278 GAGTTAGAGACTGTCCTTGCAGG + Intergenic
1010280671 6:74019213-74019235 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1010388997 6:75315015-75315037 GAGTAAGATCCTGTACTTTCTGG + Exonic
1011598360 6:89037679-89037701 GGGAAAGACCCAGTCCTGGCAGG + Intergenic
1011889062 6:92134080-92134102 GAGAAAGAGGCTGTCCTGAAGGG - Intergenic
1012658547 6:101857051-101857073 GAGAGAGAGCCTGGTCTAGCAGG + Intronic
1013596413 6:111664678-111664700 GAGAAGGAGCCTGACCATGTGGG - Intronic
1014680360 6:124421820-124421842 GAGAAAGAACCCTTCCCTGCAGG - Intronic
1014794689 6:125710890-125710912 GGGAAAGACCCAGTCCTGGCAGG + Intergenic
1016541518 6:145170885-145170907 GGGAAAGACCCAGTCCTGGCAGG + Intergenic
1017415020 6:154211118-154211140 TAGAAACAGCATGTCCTGGCTGG + Intronic
1017573386 6:155773300-155773322 GAGAAATAGCCAGTGCATGCGGG - Intergenic
1017840800 6:158221510-158221532 GAGAAACCGCCTGTCCTCACTGG - Intergenic
1018320121 6:162599578-162599600 GAGAAAGATCCTGTCAAGGCAGG + Intronic
1019368092 7:645608-645630 GAGAAACAGCCTGTCCGTGACGG - Intronic
1019607871 7:1919052-1919074 GAGGAGGTCCCTGTCCTTGCTGG - Intronic
1020068996 7:5213162-5213184 CAGACAGAGCCTGTCCTCCCTGG + Intronic
1023994347 7:45149991-45150013 GAGAAAGTTTCTGTCCATGCTGG - Intergenic
1024571301 7:50724844-50724866 GATAAACAGCCTGTCCCTGAGGG + Intronic
1025232377 7:57211290-57211312 GAGCAAAAACCTGTCCTTGCTGG + Intergenic
1027190421 7:75993143-75993165 GAGAAAGAGTCTGTCCTTGTAGG - Intronic
1027418559 7:77997921-77997943 AAGAAAGAGATTGTCCTCGCTGG - Intergenic
1027861127 7:83583393-83583415 GAGAAAGGGCTTGTCTTTGAAGG + Intronic
1032508167 7:132451558-132451580 AGGAAATAGCCTTTCCTTGCTGG - Intronic
1036434357 8:8719661-8719683 GAGAAAGAGACTGTCTATTCTGG - Intergenic
1036742101 8:11372374-11372396 GAGCAAGACCCTGTCCTGGCGGG - Intergenic
1037103594 8:15078066-15078088 GAGGAGGAGCCTGTCCTCTCTGG + Intronic
1037758567 8:21727243-21727265 GAGCGAAAGCCTGTCCTTGGAGG - Intronic
1038523118 8:28250283-28250305 GAGAAAGAGCCCTTACTTCCGGG + Intergenic
1038603596 8:28974807-28974829 GTGAAATAGTCTGTCCTGGCAGG + Intronic
1039727401 8:40233628-40233650 GAGAAAGAGCAGGTGCTTGAGGG - Intergenic
1040538359 8:48329183-48329205 GGGAAGGAGCCCGTCCCTGCAGG - Intergenic
1041902200 8:62994664-62994686 GAGAAGGAGCATCTCCTTGAAGG + Intronic
1042944185 8:74138178-74138200 GAAAAAGAGCCTGGCCTTTAGGG - Intergenic
1043433714 8:80218574-80218596 GAGCAAGAGACTGCACTTGCAGG + Intronic
1044309255 8:90674727-90674749 GAGAAAGAGCTTGTCCTTGGAGG - Intronic
1045172564 8:99687084-99687106 GAGAAGGACCCAGTCCTTGCAGG - Intronic
1047195323 8:122715779-122715801 GAGCAAGAGACCCTCCTTGCTGG + Intergenic
1047510477 8:125511904-125511926 GAGACAGAGCCTGACACTGCTGG + Intergenic
1048445537 8:134490064-134490086 GAGAAATAGCGTGGCCTGGCCGG - Intronic
1048982646 8:139711237-139711259 GAGAAAGAGCCGGTCCCCTCCGG + Intergenic
1050385438 9:5085615-5085637 GAAAAGAAGGCTGTCCTTGCTGG - Intronic
1052597036 9:30574622-30574644 GGGAAACACCCTGACCTTGCAGG + Intergenic
1053293512 9:36897595-36897617 GGGCAAGACCCTGCCCTTGCAGG - Intronic
1053456774 9:38239052-38239074 GTGGAAGAGCCTGTCCTTTTGGG - Intergenic
1055563735 9:77547655-77547677 ACTAAAGAGCCTATCCTTGCTGG + Intronic
1056684022 9:88744831-88744853 GAGACACAGCCTGTCCTGCCAGG + Intergenic
1057514709 9:95711432-95711454 GAGGGAGAGCCTGTGCTTGATGG + Intergenic
1060295030 9:122337575-122337597 GAGAGAGAGCCTGTCCTACTCGG - Intergenic
1060557010 9:124513117-124513139 GAGACAGGGCCTGTGCTTGGAGG + Intergenic
1062339450 9:136087506-136087528 GCGACAGAGCCAGTCCTCGCAGG + Intronic
1062394809 9:136348473-136348495 GAGACAGAGCGCGTCCTGGCTGG - Intronic
1203791251 EBV:152953-152975 GAGAAGGAGCCTCGCCTTGAGGG - Intergenic
1185867451 X:3636561-3636583 GAGAAAGGGCCAGCCCTGGCTGG + Intronic
1186242024 X:7579050-7579072 GAGAAAGAGCCTGACAATGAGGG - Intergenic
1186476221 X:9859702-9859724 GACAAAGGGCCTGTTGTTGCGGG + Intronic
1186619005 X:11217462-11217484 GAAAAAAAGCTTGTCATTGCTGG - Intronic
1187164054 X:16788024-16788046 AAGAAAGATCCAGTGCTTGCAGG + Intronic
1189051082 X:37646426-37646448 AAGAAAGAGCCAGGCCTTTCAGG - Intronic
1189178299 X:38979952-38979974 GGGAAAGAGCCTTTCCTTCTTGG - Intergenic
1190096399 X:47484172-47484194 GAGAGAGAGACTGTACTGGCAGG + Exonic
1191198592 X:57752230-57752252 GAGAAAGATCCAGTCCTGGCAGG + Intergenic
1192872657 X:75199443-75199465 GGGAAAGACCCAGTCCTGGCAGG + Intergenic
1193344422 X:80388461-80388483 GAGAAGGGCCCTGTCCTAGCAGG - Intronic
1193690378 X:84634472-84634494 GGGAATGAGACTGTCCTTGTTGG + Intergenic
1193708682 X:84854525-84854547 GAGAAAGAGTCTATGTTTGCAGG - Intergenic
1193710586 X:84874300-84874322 GAGAAAGAGTCTATGTTTGCAGG + Intergenic
1194095732 X:89636570-89636592 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1194468170 X:94257822-94257844 TAGAATGAGACTGGCCTTGCTGG + Intergenic
1195037045 X:100980156-100980178 GGGAAATACCCTGTCCTGGCAGG - Intronic
1195090144 X:101450787-101450809 GGGAAAGACTCTGTCCTGGCAGG - Intronic
1195115723 X:101696277-101696299 GGGAAGGACCCTGTCCTGGCAGG + Intergenic
1195824970 X:108989989-108990011 GAGAAAGACCCTGTCCTGGCAGG - Intergenic
1196182159 X:112704069-112704091 GAGAAAGATGCAGTCCTGGCAGG - Intergenic
1196270094 X:113699857-113699879 GAGAAGGACCCAGTCCTGGCAGG - Intergenic
1196368814 X:114952542-114952564 AAGAAAGATCCAGTCCTCGCAGG + Intergenic
1197602650 X:128548292-128548314 GGGAAAGACCCAGTCCTGGCAGG - Intergenic
1198840684 X:140854160-140854182 GAGAAAGAGCCAGCCATTGAAGG + Intergenic
1200177320 X:154126107-154126129 GAGAAGGACCCAGTCCTAGCGGG + Intergenic
1200237271 X:154473716-154473738 GAGAAAGGACCACTCCTTGCAGG + Intergenic
1200364304 X:155645058-155645080 GAGAAGGACCCAGTCCTGGCAGG - Intronic
1200379510 X:155819973-155819995 GAGAAAGACCCAGTCCTGGCAGG + Intergenic
1200448734 Y:3297942-3297964 GAGAAGGACCCAGTCCTGGCAGG + Intergenic
1200705213 Y:6436822-6436844 GAGAAAAAGACTTTCCTTGTTGG + Intergenic
1201028898 Y:9727886-9727908 GAGAAAAAGACTTTCCTTGTTGG - Intergenic