ID: 1129342783

View in Genome Browser
Species Human (GRCh38)
Location 15:74897135-74897157
Sequence CTTTCTCCCAACACGGAGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129342773_1129342783 30 Left 1129342773 15:74897082-74897104 CCAACCCTGTGTGAAATGCTCAG 0: 1
1: 0
2: 0
3: 17
4: 163
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342780_1129342783 0 Left 1129342780 15:74897112-74897134 CCTAGCTCCAGCAAGGACAGGCT 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342775_1129342783 25 Left 1129342775 15:74897087-74897109 CCTGTGTGAAATGCTCAGCTATA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342777_1129342783 2 Left 1129342777 15:74897110-74897132 CCCCTAGCTCCAGCAAGGACAGG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342781_1129342783 -7 Left 1129342781 15:74897119-74897141 CCAGCAAGGACAGGCTCTTTCTC 0: 1
1: 0
2: 5
3: 33
4: 304
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342774_1129342783 26 Left 1129342774 15:74897086-74897108 CCCTGTGTGAAATGCTCAGCTAT 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114
1129342779_1129342783 1 Left 1129342779 15:74897111-74897133 CCCTAGCTCCAGCAAGGACAGGC 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG 0: 1
1: 0
2: 2
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129342783 Original CRISPR CTTTCTCCCAACACGGAGTC AGG Exonic
911119152 1:94277760-94277782 CTTCCTCCCATCACTGTGTCAGG - Intergenic
911809215 1:102252650-102252672 TTTTTTCCCAAGACGGAATCTGG - Intergenic
920670403 1:207999801-207999823 CTTTCTCCCAGCCTAGAGTCTGG + Intergenic
920951460 1:210575151-210575173 ATTTCTCCCACCACAGAGTCAGG - Intronic
922581832 1:226703786-226703808 CTTTCTCCCAAGCCGGAAGCTGG - Intronic
923234785 1:232021973-232021995 CTTCCTCACAACATGGAGACTGG + Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1066448410 10:35505424-35505446 ATTTGTCTCAACACTGAGTCTGG + Intronic
1068053280 10:51979706-51979728 CATCCTCCCAAGACTGAGTCAGG - Intronic
1070624114 10:78036954-78036976 CATTCTCTCAACAGGGAGTTTGG - Intronic
1072181842 10:92991135-92991157 TTTTTTCCCAAGACAGAGTCTGG + Intronic
1075860499 10:125671843-125671865 CATTCTCCCAACACTAAATCAGG - Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1076819566 10:132931681-132931703 CTTCCTCCCCACACAGAGCCTGG + Intronic
1081367787 11:42257699-42257721 CTTTCTCACAACATGGTGGCTGG - Intergenic
1083639565 11:64138198-64138220 CTTCCTCCTAACAAGGAGGCAGG - Intronic
1086374488 11:86186418-86186440 CTCAGTCCCACCACGGAGTCAGG - Intergenic
1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG + Intronic
1091856229 12:3742531-3742553 ATTTCTCCCAGCAGGGAGCCAGG - Intronic
1093596540 12:20969044-20969066 GTTTCTCCCAAAAAGGAGTCTGG + Intergenic
1094821304 12:34228051-34228073 CTTGCTCCCAACAGAGAGACTGG - Intergenic
1096884196 12:54700106-54700128 CTCTCTCCCACCATGGAGCCTGG - Intergenic
1103942705 12:124509654-124509676 CCTTCCCCCTACACTGAGTCTGG - Intronic
1104755669 12:131267845-131267867 CTATCTCCCCACACTGAGTATGG - Intergenic
1105616908 13:22027349-22027371 CTGTCACCCAAGACGGAGTGCGG - Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1114331091 14:21637840-21637862 CTTTCTTTCAACAGGGAGCCTGG - Intergenic
1117976503 14:61302369-61302391 CTTTCCCCCAACCCGGACCCAGG - Intronic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1125023721 15:35009852-35009874 CTGTCACCCAACTCAGAGTCTGG + Intergenic
1129325504 15:74798414-74798436 CTTTTTCCCAGCACTCAGTCAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131679911 15:94710498-94710520 CTTTCTCCCAGGCCGGAGTGCGG + Intergenic
1134819123 16:17231349-17231371 CTTTCTCCCCACAGGCAGTGGGG + Intronic
1135671754 16:24381580-24381602 CTTTTTCCCAACAAGGAATTTGG - Intergenic
1139490005 16:67280868-67280890 CTTCCTCCCCACAGGGACTCGGG + Exonic
1140450664 16:75068458-75068480 CTTTCTCCCACAGCAGAGTCGGG + Intronic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141661626 16:85444699-85444721 TTTTCTAGCAACACGGAGCCCGG - Intergenic
1142391012 16:89799980-89800002 CTTTTTTCCGAGACGGAGTCTGG - Intronic
1145911735 17:28547156-28547178 CTTCCTCCCAACATTGACTCAGG + Exonic
1147053548 17:37816512-37816534 CTTTATCCCATCACGGTTTCAGG - Intergenic
1153619465 18:6963377-6963399 CTTCCTGCCAAGACGGAGCCAGG - Intronic
1157007628 18:43604187-43604209 CACTCTCCCAAGACTGAGTCAGG - Intergenic
1159460796 18:68720603-68720625 CACTCTCCCAGCAAGGAGTCTGG - Intronic
1164070611 19:21764626-21764648 TTTTTTCCCCACACGGAGTCTGG - Intronic
1168607556 19:57771834-57771856 TTTTTTCCCAAGATGGAGTCTGG + Intronic
926286111 2:11489445-11489467 TTTTCCCCCAAGACGGAGTCTGG - Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
928595458 2:32855472-32855494 CTGACTCCAAACACTGAGTCAGG - Intergenic
929804216 2:45130456-45130478 CTTTCTCACAACACTGTGGCTGG + Intergenic
932064321 2:68537126-68537148 CTGTCTCCCAACCTGGAGTGTGG - Intronic
942212102 2:173681503-173681525 CTTCCTCACAACATGGTGTCTGG + Intergenic
942673602 2:178403382-178403404 CTGTCTCCCAACCTGGAGTGCGG - Intergenic
945374227 2:209060662-209060684 CTTTGTCCCAACCAGGAGTCAGG - Intergenic
946009669 2:216554641-216554663 AGTTCTCCCAACTCGAAGTCAGG - Intronic
946049512 2:216850247-216850269 CTTTCTAGCAACACAGAGTGAGG + Intergenic
947041975 2:225932723-225932745 CTGTTTCCCAAAACAGAGTCTGG - Intergenic
947683503 2:232058825-232058847 CTTTCTTACATCACTGAGTCAGG - Intronic
948466290 2:238153306-238153328 CCTTCTCCCAAGACGGGGTGGGG - Intergenic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG + Intergenic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1174296883 20:49552041-49552063 GTTTCTCCCCAGAAGGAGTCTGG - Intronic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1176230923 20:64032537-64032559 CCTTCTCCAAACAAGGAGTTAGG - Intronic
1178343315 21:31804507-31804529 CTTTCTTTCAAGACAGAGTCTGG + Intergenic
1178377257 21:32076862-32076884 CTTTCTCGCCACACGGGGGCTGG - Intergenic
1179104026 21:38382534-38382556 CTTTCTCCTAACACTGGGTTTGG + Exonic
1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG + Intronic
1183888220 22:40902830-40902852 CTGTCTCACAGCAAGGAGTCTGG + Intronic
951517864 3:23581617-23581639 CTTAGTTCCACCACGGAGTCAGG - Intronic
957785652 3:84878686-84878708 CTCTCTCCCACCACTGAGTATGG + Intergenic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
962851805 3:139313700-139313722 CTTTCTCCCAAGACTGAAACAGG - Intronic
964320595 3:155492736-155492758 CGATCTCCAAACATGGAGTCTGG + Exonic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
966001088 3:174949251-174949273 CTTTCTCACAACACCCAGTAGGG + Intronic
968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG + Intronic
974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG + Intergenic
977689181 4:99884952-99884974 TTTTCTTCCAAGACAGAGTCTGG - Intronic
977987756 4:103404584-103404606 CTTCCCCCCGAGACGGAGTCTGG + Intergenic
978382170 4:108140639-108140661 CTTTCCCCTCACCCGGAGTCAGG + Intronic
979041244 4:115799397-115799419 CTTTCTCTCAACATGCAATCAGG + Intergenic
984877980 4:184386322-184386344 CTTCTTCCCAACACAGACTCAGG - Intergenic
986296632 5:6444724-6444746 CTTCCTCTCAACATGGTGTCTGG + Intergenic
990922889 5:60987205-60987227 CATTCTCCCAAGACTGAGCCAGG + Intronic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
996275121 5:121656485-121656507 CTTTCCCTCAACAAGAAGTCAGG + Intergenic
996953904 5:129160761-129160783 CATTCTCCCAAGACTGAGCCAGG - Intergenic
997432641 5:133851348-133851370 CTTTCTCCCATCTTGGAGACTGG - Intergenic
997831322 5:137153049-137153071 CTCTCACCCAACACAGTGTCTGG + Intronic
1001454068 5:171847412-171847434 CTTTCTCCCAATAAGGACTCTGG + Intergenic
1001644886 5:173272965-173272987 CTTTCTCCCATCACACAGGCTGG - Intergenic
1002966261 6:1969644-1969666 CTTCCTCCCATCTCAGAGTCTGG + Intronic
1006658377 6:35617078-35617100 CTATCTCCCAACTCCTAGTCTGG + Intronic
1006739401 6:36296679-36296701 CTTTCTCCCAACAAGGGGGGTGG + Intronic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1007613788 6:43168298-43168320 CTTTGTCACCACAGGGAGTCAGG - Intergenic
1015349982 6:132206794-132206816 CATTCTCCCAAGACTGAATCAGG - Intergenic
1027216266 7:76185787-76185809 CCTTCCCCCAACACAGAATCAGG - Intergenic
1029546645 7:101213726-101213748 CTCACTCCCAACACGCAGGCTGG + Intronic
1030156442 7:106460380-106460402 GTTTCTCCCAAGACAGAGTGGGG - Intergenic
1034778921 7:153859334-153859356 CTTTCTCTCAAGCTGGAGTCGGG + Intergenic
1036222245 8:6930541-6930563 CTTCCTCAAAACACGGTGTCTGG - Intergenic
1037419354 8:18685885-18685907 CTTTATCCCCACACAGAGGCAGG - Intronic
1039495350 8:37976040-37976062 CTTTATCCCATCACGGAGAGGGG + Intergenic
1041157680 8:55004976-55004998 CTTTTTCCCAACACTGCGTTAGG + Intergenic
1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG + Intronic
1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG + Intronic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1056623548 9:88235388-88235410 CCTTCTCCCAAGACAGTGTCTGG + Intergenic
1058869226 9:109188285-109188307 CTTTCTCCAGACACTGAGGCTGG + Intronic
1185497758 X:570660-570682 CTTGCTCCCATCACAGAGGCTGG + Intergenic
1185500249 X:591397-591419 CTTTTTCTCTGCACGGAGTCTGG + Intergenic
1189863856 X:45302354-45302376 GTTTCTCCCAAAAAGGAGTTTGG - Intergenic
1190080657 X:47354600-47354622 CCTTCTCCCAACAGGAAGCCTGG - Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1195098790 X:101532932-101532954 TATTCTCCCAACAGGGAGGCAGG - Intronic
1197886845 X:131227250-131227272 CTTCCTCCCATTAGGGAGTCAGG + Intergenic
1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG + Intergenic
1199978123 X:152906078-152906100 CTTTCTCCCCTCATGGTGTCTGG - Intergenic