ID: 1129348214

View in Genome Browser
Species Human (GRCh38)
Location 15:74937915-74937937
Sequence CCGGACCCCCGGCCCCGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 382}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129348214_1129348224 5 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348224 15:74937943-74937965 GTGCAGGAGGCCTCGAGGGTCGG 0: 1
1: 0
2: 4
3: 18
4: 194
1129348214_1129348225 10 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348225 15:74937948-74937970 GGAGGCCTCGAGGGTCGGCCCGG 0: 1
1: 1
2: 1
3: 14
4: 169
1129348214_1129348226 11 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348226 15:74937949-74937971 GAGGCCTCGAGGGTCGGCCCGGG 0: 1
1: 1
2: 0
3: 20
4: 148
1129348214_1129348223 1 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348223 15:74937939-74937961 CGGAGTGCAGGAGGCCTCGAGGG 0: 1
1: 1
2: 3
3: 9
4: 118
1129348214_1129348229 20 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348229 15:74937958-74937980 AGGGTCGGCCCGGGTGGTTGCGG 0: 1
1: 0
2: 0
3: 15
4: 131
1129348214_1129348227 14 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348227 15:74937952-74937974 GCCTCGAGGGTCGGCCCGGGTGG 0: 1
1: 1
2: 0
3: 9
4: 120
1129348214_1129348222 0 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348222 15:74937938-74937960 GCGGAGTGCAGGAGGCCTCGAGG 0: 1
1: 1
2: 2
3: 13
4: 204
1129348214_1129348220 -8 Left 1129348214 15:74937915-74937937 CCACGGCGGGGCCGGGGGTCCGG 0: 1
1: 0
2: 2
3: 38
4: 382
Right 1129348220 15:74937930-74937952 GGGTCCGGGCGGAGTGCAGGAGG 0: 1
1: 0
2: 0
3: 19
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129348214 Original CRISPR CCGGACCCCCGGCCCCGCCG TGG (reversed) Exonic
900095974 1:940298-940320 CCCCCCCCCCCGCCCCGCCGCGG + Intronic
900096689 1:942747-942769 CCGGACCCCCCACCCCGTCCCGG + Exonic
900154236 1:1197691-1197713 CCGGCCACCCGGCCCCGACCTGG + Exonic
900205015 1:1427937-1427959 CCGCAGCCCCGCCCCCGCCACGG + Intergenic
900213535 1:1468787-1468809 ACGGGCACCCGGCCCCGCCGTGG - Exonic
900221096 1:1509603-1509625 ACGGGCACCCGGCCCTGCCGTGG - Intergenic
900266541 1:1760000-1760022 CTGCCCTCCCGGCCCCGCCGTGG - Intronic
900289183 1:1916646-1916668 CCTGACCCAGGGCCCCCCCGAGG - Intronic
900289735 1:1918859-1918881 TCGGACGCACGGCTCCGCCGCGG + Intronic
900366924 1:2315208-2315230 CCCCACCCCAGGCCCCGCGGAGG + Intergenic
900533638 1:3166711-3166733 CCGGGCCCCAGGCCGCGCTGTGG - Intronic
900641238 1:3689033-3689055 GCGGAACCCAGGCCCCGCCTCGG + Intronic
900650920 1:3729780-3729802 CCTGCCTCCCGGCCCCGCCATGG + Intronic
901238751 1:7680978-7681000 CCTGCCCCCCGGCCCCAACGTGG - Intronic
901443545 1:9293327-9293349 CGGGACCCCCTGCCCTGCAGCGG - Intronic
901704062 1:11060221-11060243 CCGGCCGCCCGGCCCCGGCCGGG - Intergenic
902768309 1:18631243-18631265 CCGGAGACCAGGCCCCGCGGCGG - Exonic
903468451 1:23568409-23568431 CCCGGCGCCTGGCCCCGCCGCGG - Intergenic
903767937 1:25746797-25746819 CCCGCCCCCCTCCCCCGCCGAGG - Intronic
903928506 1:26848864-26848886 CCAGACCCCCTGCCCAGCCCTGG - Intronic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904500110 1:30908503-30908525 GCGGGCCCCGGGCCCGGCCGCGG + Exonic
904840394 1:33368535-33368557 CCGGCCCCCCACCCCCGCCCAGG - Exonic
906044407 1:42817062-42817084 CCGGCCCCCCGACCCCGCCCCGG + Intronic
906062539 1:42958192-42958214 CCGAGCCCCCGGCCCGGCCCCGG - Intronic
906805552 1:48776533-48776555 CCGGGCCCCCGGCCCCTCCCGGG + Intronic
907278076 1:53327909-53327931 CCGGAGCCCCGGGCCCGCCATGG - Exonic
910771514 1:90836226-90836248 CCGTCCACCCCGCCCCGCCGGGG - Intergenic
910981240 1:92961539-92961561 CCACTCCCCCGCCCCCGCCGCGG + Intergenic
912460389 1:109827025-109827047 CCGGGCCCCAGGCACAGCCGTGG + Intergenic
913186517 1:116374029-116374051 CCGGGCCTCCGTTCCCGCCGCGG + Exonic
914677867 1:149917766-149917788 CGGGACCCCCGTCCTCGCCCGGG - Exonic
915246330 1:154558567-154558589 CCGGCCCGCCGGCCCCGGAGCGG - Exonic
915311034 1:155005889-155005911 CCAGTCCCCCGGGCCCGCCTTGG - Intronic
915358795 1:155273265-155273287 CCGGAGTCCCGGCACCCCCGCGG + Exonic
915617097 1:157046779-157046801 CCTGACCTCAGGCCCCGCCTCGG - Intergenic
915934743 1:160083923-160083945 CAGGACCCCCGACGCCGCCTAGG + Exonic
916651584 1:166839375-166839397 GCCGTCCCCCGGCGCCGCCGAGG + Intergenic
916694393 1:167221312-167221334 CCGGCCCCGCCGCCCCGCCGCGG - Intronic
917846726 1:179026127-179026149 CGCGACCCCCGCCCCCGGCGCGG + Intronic
918093776 1:181318202-181318224 CCAGACCCGTGGCGCCGCCGGGG - Intergenic
920218406 1:204377768-204377790 CCGGACCCCCTCCCCCACCACGG - Intergenic
921850521 1:219928454-219928476 CCGGGCGCCCGGCGCCGCCCAGG + Exonic
1062767486 10:76538-76560 CCGAAGCCCCGGCCCCTCCGGGG + Intergenic
1062873880 10:930957-930979 CCGCGACCCCGGCCCCGCCCAGG + Intronic
1062932682 10:1363288-1363310 CCCGACCCCCGCCACCCCCGCGG - Exonic
1065214998 10:23439915-23439937 CCGCAGCCCCGGTCCCGCCGCGG + Exonic
1065727943 10:28684399-28684421 CCCTGCCCCCTGCCCCGCCGCGG + Intergenic
1067431522 10:46249021-46249043 CAGGACCCCCCGGCCCGCCATGG + Intergenic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1069419151 10:68231188-68231210 CCGGACACCCACCCCCGCGGAGG + Exonic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1071618173 10:87094969-87094991 CCGGGCCTCCGCCTCCGCCGCGG + Intronic
1073212664 10:101817878-101817900 CCGCTCCCCCAGCCCCGGCGGGG + Exonic
1073291853 10:102417035-102417057 CCTGACCCCCGGCCCCAGCATGG - Exonic
1073325740 10:102643407-102643429 CCAGACCCCGGCCGCCGCCGCGG + Intergenic
1074503445 10:114045385-114045407 CCGGACCCCCGCCATCGCCCGGG + Exonic
1075430298 10:122374772-122374794 CCGGAGCACCCGCGCCGCCGCGG - Exonic
1076116840 10:127907032-127907054 CCAGGCCCCCGCCCCCGCCGCGG + Intergenic
1076211168 10:128646082-128646104 CCTGACCCCCCGCCCAGCCTTGG - Intergenic
1076710644 10:132331995-132332017 CCCGACCCCCTGCCGCGCAGGGG + Intergenic
1076724022 10:132405075-132405097 CCGGACCCCCAGCCGCGCCCAGG + Exonic
1076817924 10:132923597-132923619 CCGGACCCCCGGCCTCGAGCAGG + Intronic
1077047025 11:551216-551238 CAGGCCCACCGGCCCCCCCGCGG + Exonic
1077058424 11:607223-607245 CCGCACCCCCGCCCGCACCGCGG + Exonic
1077108067 11:850417-850439 CCAGACCCCGCGACCCGCCGCGG - Intronic
1077250108 11:1557141-1557163 CGGGCCCCCCGACCCCGGCGAGG - Exonic
1077514209 11:2992059-2992081 CCAAGCCCCAGGCCCCGCCGCGG + Intronic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1079355891 11:19730199-19730221 CTGAACCCCCGACCCTGCCGAGG - Intronic
1079430888 11:20387614-20387636 CCGGAGCCCGGGTCCCGCCGCGG + Exonic
1083648186 11:64185349-64185371 CGGGACAGCCGGGCCCGCCGCGG + Exonic
1083743518 11:64723104-64723126 CCCGCCCGCCCGCCCCGCCGCGG + Exonic
1083788934 11:64971653-64971675 CCGGTCCCGCGGCCTCCCCGTGG + Intronic
1083901818 11:65647020-65647042 CGGGTCCCCCGGCCAAGCCGTGG + Exonic
1084112563 11:67023431-67023453 CCGGAGCGGCGGCCCCTCCGCGG + Intronic
1084165301 11:67372613-67372635 CCCCGCCCCCGCCCCCGCCGCGG - Intronic
1084385808 11:68841986-68842008 GCGGACGCCCCGCCCCGCCGAGG - Intronic
1084387737 11:68854752-68854774 CTGGACCCCCAGCCCCTCTGCGG - Intergenic
1084432105 11:69116864-69116886 CCTGACCCCCGACCCTGCCTGGG + Intergenic
1084541487 11:69789683-69789705 CCAGTCCCCCGGCCCCACGGTGG + Intergenic
1084586925 11:70067752-70067774 CCCGACCCCCTGCCCCGGCTTGG + Intergenic
1084758358 11:71252689-71252711 CCCCACCCCCGCCCACGCCGCGG + Intergenic
1084973058 11:72781776-72781798 CCCGCCGCCCGGCCCCGCCCCGG + Intronic
1084978152 11:72814444-72814466 GGGGACGCCCGGCCCCGCCATGG - Exonic
1089993385 11:122882776-122882798 CCGCACCCCCGGCCCTGGCACGG - Exonic
1090857827 11:130625754-130625776 CCGGAGCCCCAGTCCCGCCTGGG + Intergenic
1091498281 12:991162-991184 CCCCGCCCCCAGCCCCGCCGCGG - Intronic
1091730532 12:2877094-2877116 CCCCACCCCCGGCCCCGGCCCGG - Intronic
1091807319 12:3365912-3365934 CCTGCCCGCCGGCCCCGCCACGG + Intergenic
1092143582 12:6200229-6200251 CCCGCCCCCCGCCCCCGCCCAGG - Intronic
1092143599 12:6200262-6200284 CCGCCCCACCGGCCCCGCCCGGG - Intronic
1096191579 12:49623464-49623486 CCGGAGCCCCGGCCACGAAGGGG + Exonic
1096284138 12:50283538-50283560 CCGGACCCCGCCCACCGCCGCGG + Intronic
1096627251 12:52903563-52903585 CCGGGCCCCCGGCGGCCCCGAGG - Intronic
1097267756 12:57755616-57755638 CCGCCTCCCCGGCCCCCCCGGGG - Exonic
1097938633 12:65279346-65279368 CCGCACCCCCGTCCTCTCCGAGG - Intronic
1098105992 12:67069389-67069411 CCGGCCTCCCGGCCACACCGCGG - Intergenic
1100490460 12:95073327-95073349 CCTGGCCCCCGCCCCCGACGCGG + Intronic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1103120058 12:118372740-118372762 CCGGACCCAAGGATCCGCCGGGG - Exonic
1104739927 12:131164780-131164802 CAGCTCCCCCAGCCCCGCCGCGG + Intergenic
1104792552 12:131493185-131493207 CAGCTCCCCCAGCCCCGCCGCGG - Intergenic
1104928034 12:132323804-132323826 CCGGGCCCCCGCCCCGGCCGAGG - Intronic
1105801159 13:23903966-23903988 ACGGACCCCAGGCCCCGGCAGGG - Intergenic
1105847718 13:24307970-24307992 ACGGACCCCAGGCCCCGGCAGGG + Intronic
1107133327 13:36919686-36919708 CCCGACCGCCGCCCCCGCCGCGG + Intronic
1107133432 13:36920057-36920079 CCCCAACCCCGCCCCCGCCGTGG + Intronic
1109062320 13:57633752-57633774 CGGAACCCCCGGGCCCGCCCAGG - Exonic
1109829923 13:67773028-67773050 CCTGAGCCCCCGCCCCGCGGTGG - Intergenic
1112344303 13:98577173-98577195 CCGCCCCCACGGCCCGGCCGGGG + Intronic
1112402184 13:99086678-99086700 CCGGACACCCCGCCCCGAGGAGG - Intergenic
1113820273 13:113208722-113208744 TGGCGCCCCCGGCCCCGCCGCGG + Intronic
1113886092 13:113659013-113659035 CCGGACCCCCGGTGACCCCGAGG - Intergenic
1116817853 14:49599765-49599787 CCGGATCCCCGCCCCGGCCCCGG - Intronic
1117388540 14:55240973-55240995 CCCAACCCCCGGCCCCGCCGCGG - Intergenic
1117722178 14:58638418-58638440 CCGCACCCCCGGCGCCGCGCAGG - Exonic
1118332180 14:64823434-64823456 CCAGACCAGCCGCCCCGCCGCGG + Intronic
1118339149 14:64880002-64880024 CCGCCTCCCCGCCCCCGCCGCGG - Intergenic
1118810726 14:69271251-69271273 CCAGAGCCCCGGCCCCGGTGTGG - Intronic
1122108989 14:99481680-99481702 CCGGCCTCCCTGCCCCGCCCCGG - Intronic
1122270789 14:100567772-100567794 CCTGGCCCGCAGCCCCGCCGAGG + Intronic
1122689126 14:103523192-103523214 CCGGCCCCTCGCCGCCGCCGCGG - Intergenic
1122884921 14:104706665-104706687 CAGCACCCCCTGCCCAGCCGTGG - Intronic
1125674787 15:41496058-41496080 CCCCACCCCCAGGCCCGCCGGGG + Intronic
1126113323 15:45187846-45187868 CCGCACCCCCGGCGCCCCGGCGG + Intronic
1129348214 15:74937915-74937937 CCGGACCCCCGGCCCCGCCGTGG - Exonic
1129351324 15:74957367-74957389 CCGGACCCCCGTCCACCCCTGGG + Exonic
1129408555 15:75336260-75336282 CCGTACCCCCGCCCCCGTCTCGG - Intronic
1129955603 15:79634132-79634154 CCCCACCCCCTGCCCCGCTGGGG + Intergenic
1131510109 15:93045041-93045063 CTGGCCCCCCGGCCCCTCCTGGG - Exonic
1132578763 16:675764-675786 CCGGACCCCGGCCCCCGGCCAGG + Exonic
1132593087 16:734989-735011 CCAAAGCCCCGGCCCCACCGTGG + Intronic
1132683452 16:1153026-1153048 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1132754167 16:1474667-1474689 CCGCCAGCCCGGCCCCGCCGAGG + Intronic
1132779333 16:1614277-1614299 CCAGACCCGCGCCCGCGCCGGGG + Intronic
1132866954 16:2097825-2097847 CAGGACCCCCAGCCCAGCCCAGG + Intronic
1132978300 16:2721258-2721280 ACCGACCCCCGGCGCCGGCGGGG - Intergenic
1133784290 16:8963166-8963188 GGCGCCCCCCGGCCCCGCCGCGG + Intronic
1134132153 16:11657250-11657272 CCAGACCCCCTTCCCCACCGCGG - Intergenic
1134438868 16:14285744-14285766 CCGAGCCCCCGAGCCCGCCGGGG + Intergenic
1134459781 16:14421217-14421239 CCGGACTCCTGGCCACGCTGAGG - Intergenic
1134548087 16:15125648-15125670 CAGGACCCCCAGCCCAGCCCAGG + Intronic
1134720266 16:16377077-16377099 CAGGACCCCCAGCCCAGCCCAGG - Intergenic
1134947161 16:18334808-18334830 CAGGACCCCCAGCCCAGCCCAGG + Exonic
1135325000 16:21520526-21520548 CCCGACCCGTGGCCCGGCCGCGG + Intergenic
1135517708 16:23149308-23149330 CCCGGCCCGCGGCCCCGCCACGG + Intergenic
1135821773 16:25692063-25692085 CCGCTTCCCCGGCTCCGCCGCGG - Exonic
1136141662 16:28292605-28292627 CCGGAGCCCGGGCCAGGCCGGGG + Exonic
1136536392 16:30902320-30902342 CCGGGCCCTGGGCGCCGCCGTGG + Exonic
1136778849 16:32885150-32885172 CCCAACCCCCGGAGCCGCCGCGG - Intergenic
1136779092 16:32885937-32885959 CCGCGCCCCCGGCCCCGACCGGG + Intergenic
1136891525 16:33975581-33975603 CCGCGCCCCCGGCCCCGGCCGGG - Intergenic
1136891769 16:33976368-33976390 CCCAACCCCCGGAGCCGCCGCGG + Intergenic
1137426430 16:48384955-48384977 CTGGAGCCCCGGGCCCGGCGGGG - Intronic
1137454786 16:48609988-48610010 GCCGGCCCCCGGCGCCGCCGCGG - Exonic
1138370153 16:56520142-56520164 CCGCACCCGCGGCCCAGCAGGGG - Exonic
1138389114 16:56657638-56657660 CCCGCCCCCCGGCCCCGCCCCGG - Intronic
1139467094 16:67159845-67159867 TGGGAACCCAGGCCCCGCCGAGG - Exonic
1139509179 16:67416550-67416572 CCGGTCCCCCGGCCAGGGCGGGG + Intronic
1139596714 16:67962357-67962379 CAGGTCCCCCAGCCCCACCGGGG + Intronic
1139775103 16:69311778-69311800 CCGGCGCCCCGGTACCGCCGTGG + Intronic
1141464508 16:84196981-84197003 CCGGGACCTCGGTCCCGCCGAGG - Exonic
1142120467 16:88384025-88384047 CTGCCCCCCCGCCCCCGCCGGGG - Intergenic
1142156075 16:88533400-88533422 CTGGGCCCCAGGCCCCGTCGCGG + Exonic
1203081507 16_KI270728v1_random:1148025-1148047 CCGCGCCCCCGGCCCCGGCCGGG + Intergenic
1142603616 17:1069876-1069898 CAGGACCCCCTCCCCCGCCCCGG + Intronic
1142757569 17:2025000-2025022 CCGGTGGCCCGGCCCCGCAGGGG + Exonic
1142806783 17:2375578-2375600 CGGGACTCCGGGCACCGCCGTGG + Exonic
1143150851 17:4807107-4807129 CCTGAGCCCCGGCCCCGCCTCGG + Exonic
1143390489 17:6556616-6556638 CCCCACCCCCCGCGCCGCCGGGG + Intergenic
1144586829 17:16492213-16492235 CCCGCCCGCCGGCCCCGCCCCGG + Intergenic
1144586976 17:16492700-16492722 GCGGATCCCAGGCCCCACCGAGG - Intergenic
1144682606 17:17205632-17205654 CCGGACCCTCGGTGCCTCCGCGG - Intronic
1144847146 17:18225841-18225863 CCCGCCCCCCGGGCCCGACGTGG - Intronic
1145897168 17:28465912-28465934 CCAGACTCCCAGCCCCGCTGGGG + Intronic
1147150267 17:38510188-38510210 CCGCTCCTCCGGCGCCGCCGGGG - Exonic
1147184250 17:38705190-38705212 CCGGCCCCCCTGCCCGGCCGCGG - Intergenic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147720395 17:42536314-42536336 CCGCGCCCCCGGCCCCGGCCAGG - Exonic
1148048717 17:44759082-44759104 CCGGCCCCGCGCCCCCGCCCCGG + Exonic
1148553467 17:48564292-48564314 CCGGACCCTCGGCCCAGGCTGGG + Intronic
1148563468 17:48619513-48619535 CGGGAGCCCCGGCCCAGCTGCGG + Intronic
1148746206 17:49919867-49919889 CTGGACCCCTGGCCCCATCGCGG + Intergenic
1148818226 17:50345998-50346020 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1150830303 17:68512664-68512686 CCGCACCCCCTGCCCCTCCCCGG + Intronic
1151438473 17:74113398-74113420 CCCCGCCCCCGCCCCCGCCGTGG - Intergenic
1151681895 17:75626759-75626781 CCCGACCCCAGGCTCCGCCCAGG + Intergenic
1151724063 17:75874652-75874674 AAGGCCTCCCGGCCCCGCCGGGG - Exonic
1151817138 17:76476983-76477005 CCAGTCCCCGGGCCCCGGCGCGG - Exonic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1152683899 17:81684259-81684281 CTGGACCCTCGGCGCGGCCGTGG + Intronic
1152683903 17:81684265-81684287 CCGACCCCACGGCCGCGCCGAGG - Intronic
1152758997 17:82098572-82098594 CCCGACCCCCGTGTCCGCCGGGG + Intergenic
1152924487 17:83080866-83080888 CCCCGCCCCCGCCCCCGCCGCGG + Intronic
1152960321 18:75884-75906 CCGAAGCCCCGGCCCCTCCGGGG + Intergenic
1153688210 18:7567253-7567275 ACGGCCGCCCGGCGCCGCCGCGG - Exonic
1153911252 18:9708252-9708274 CTGGGCCGCCGGCCCCGCCGCGG - Exonic
1155003351 18:21706793-21706815 CCGCACCCCCCGCCCCACTGTGG + Intronic
1156275789 18:35581706-35581728 CCGGACCCGCCCGCCCGCCGGGG + Intronic
1156448593 18:37254055-37254077 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1160453266 18:78979518-78979540 CCGGCCCCGCGTCCCCTCCGCGG - Intergenic
1160772903 19:841017-841039 CCGGCCCCCCAGCCCTGCCCTGG + Exonic
1160812914 19:1020678-1020700 CGCGACCCCTGGCCCCGCTGGGG - Intronic
1160873091 19:1285871-1285893 CCGGAGCCCGGGCCCCTCCCCGG + Intergenic
1160890871 19:1378113-1378135 CCTGACCCCCGCCTCCTCCGGGG - Exonic
1160930486 19:1567701-1567723 CCCGACCCTGGCCCCCGCCGTGG - Exonic
1160991818 19:1863275-1863297 CCCGGGCCCCGGCGCCGCCGCGG - Exonic
1161015097 19:1979449-1979471 CCCCACCCCCACCCCCGCCGAGG + Intronic
1161171367 19:2813939-2813961 GCTGACCCCCAGCCCCGCCCCGG - Exonic
1161215811 19:3094586-3094608 CCCGGCCCCCGGCCCGGCCCTGG - Exonic
1161265030 19:3359992-3360014 CCGGGCCCCCGCCCCCTCCCCGG + Intronic
1161266456 19:3366797-3366819 CCGGACCCCAGCCCTCGGCGCGG - Intronic
1161327283 19:3669976-3669998 CCTGACCCCAGGCCCCTCCCCGG - Intronic
1161392699 19:4029411-4029433 CAGCACCCTCGGCCCCGCTGAGG - Intronic
1161443245 19:4304430-4304452 CTCGACCCCTGGCCCTGCCGTGG - Intergenic
1161512383 19:4679004-4679026 CCGAAGCCCCGCCCCCGCTGAGG + Intronic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1162079356 19:8209297-8209319 CCGCCCCCACGGCCCCGCCCCGG + Intronic
1162113371 19:8413393-8413415 GCGGCCGCCCGGCCCGGCCGCGG + Intronic
1162809671 19:13156163-13156185 GCCGACCCCCGCCCCCGCCCGGG + Intergenic
1162951373 19:14073641-14073663 GCCGTCCCCCGCCCCCGCCGAGG - Exonic
1162966576 19:14159059-14159081 CCCCACCCGAGGCCCCGCCGGGG + Intronic
1163006902 19:14402586-14402608 CTGTTCCCCAGGCCCCGCCGTGG + Exonic
1163138645 19:15331955-15331977 CCCGACCGCCGGCCCCGCCGCGG + Intronic
1163157875 19:15449248-15449270 CTGGCGCCCCGGCCCCGCCCCGG - Intronic
1163403770 19:17110174-17110196 CCTGACCCCCGCCCCCCGCGAGG + Intronic
1163509707 19:17727356-17727378 CCGGCCTCCCCGCCCCGCAGTGG - Exonic
1163708608 19:18832350-18832372 CCGGGCCGCCGGGGCCGCCGGGG - Exonic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1164835241 19:31351449-31351471 TCGGACTCCCTGCCCCGCCTGGG - Intergenic
1166275019 19:41747473-41747495 CAGGACCCCCGTCCCCGTCCTGG + Intronic
1166677479 19:44748628-44748650 CCCCGCCCCCGGCCCCCCCGGGG - Exonic
1167110402 19:47457357-47457379 CCTGGGCCCGGGCCCCGCCGAGG - Exonic
1167134295 19:47608240-47608262 CCGCCTCCCCGGCGCCGCCGTGG + Exonic
1167369585 19:49072626-49072648 CCCGACGCCCGGCCCCGGTGCGG + Exonic
1167386289 19:49166068-49166090 CCGGACCGCCCACCCCGCAGTGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
924968556 2:101200-101222 CCGCACCCCCGGGCCTGCCAGGG - Intergenic
925312163 2:2892537-2892559 CCGGATCCCTGGCCCTGCCTCGG + Intergenic
927210634 2:20637032-20637054 CCGCCCCCCCCGCCCCGCCAAGG + Intronic
927679938 2:25132590-25132612 CCCGACCCCCCGCTCCGCCCTGG + Intronic
927698503 2:25252666-25252688 CCGGACCCCCGGCTCCCTCCGGG - Intronic
929188695 2:39120705-39120727 CCGGCCCGCCGGCGCCGCCCCGG + Intronic
929966838 2:46542821-46542843 CCGGATCCCCGCCCCGGCCCCGG - Exonic
933442710 2:82334006-82334028 CCCCACCCCCGGCCCCACCAAGG - Intergenic
936507089 2:113116485-113116507 CCCCACCCCCCGCCCCGCCTGGG - Intronic
936688134 2:114852620-114852642 TCAGACCCCCGCCCCCGCCGCGG - Intronic
938258740 2:129880477-129880499 CCTGACCCCCGGCCCCGTGATGG + Intergenic
941111763 2:161424235-161424257 CTGCCCGCCCGGCCCCGCCGCGG + Exonic
945119566 2:206443739-206443761 CCGGAGCCCCCTGCCCGCCGCGG + Exonic
946306523 2:218859744-218859766 CCTGCCCCCCGCCCCCGCCTCGG + Intergenic
947593030 2:231395842-231395864 CCGGGCCCACGCCCCCGCCCAGG - Intronic
948645353 2:239400814-239400836 CTGGGCCCCCGGCGGCGCCGTGG - Exonic
1168769797 20:408018-408040 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1168814564 20:728090-728112 CCGGACCCCGGCCCACGCGGCGG - Intergenic
1169073737 20:2749521-2749543 CAGGACCCCCGGCCCAGCCCCGG + Intronic
1169142447 20:3234054-3234076 CCGGTCTCCCGGCCCGGGCGGGG - Intronic
1169214738 20:3786524-3786546 CCGGGCCCCCCGCCCCGGGGCGG - Exonic
1169327550 20:4687257-4687279 CCCGGACCCCGCCCCCGCCGAGG - Intronic
1170852482 20:20017538-20017560 CCGGACCCCAAGCCCGGACGGGG + Intronic
1171473645 20:25390915-25390937 CCCCTCCCCCGGCCCCGCCCCGG + Exonic
1172919979 20:38473074-38473096 CCGGGCAGCCGGCCCCGCCGCGG + Intronic
1173728399 20:45312411-45312433 CCTGACCCCCGGCCCGGGCGGGG + Intronic
1174579921 20:51564136-51564158 CCCCACCCCCAGCCCCGCCCAGG + Intergenic
1175199157 20:57266285-57266307 CCGGACCCCCGCCCCCTGCTCGG + Exonic
1176127472 20:63482418-63482440 CTGGACCCCCTGCCCAGACGTGG - Intergenic
1176223550 20:63981300-63981322 CCTCACCCCCGGCCCAGCCCCGG - Exonic
1176268137 20:64221277-64221299 CTGGACCCCTGGCCCCTCCGTGG + Intronic
1176548456 21:8211865-8211887 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1176556350 21:8256073-8256095 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1176567387 21:8394900-8394922 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1176575289 21:8439115-8439137 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1178992786 21:37368147-37368169 GCGGACCCCCAGGGCCGCCGAGG - Intronic
1179411812 21:41168239-41168261 GCGCCCCCCGGGCCCCGCCGTGG + Exonic
1179424138 21:41260070-41260092 TTGACCCCCCGGCCCCGCCGTGG + Intronic
1179508883 21:41859177-41859199 CCGCATCCCCTGCCCCGCCTGGG + Exonic
1179512024 21:41879418-41879440 CAGGACCCCCGGCCGCGCCAGGG - Exonic
1179545257 21:42109077-42109099 CTGGACCCCCACCCCCGGCGTGG + Intronic
1180000274 21:44992451-44992473 CCCGACCCCTGGTCCCGCCATGG + Intergenic
1180083686 21:45497985-45498007 GCCGACCCCCGGCCCCGTGGAGG - Intronic
1180158793 21:45990019-45990041 GGGGACCCCCGGCTCCGCAGAGG - Intronic
1180158808 21:45990053-45990075 GGGGACCCCCGGCTCCGCAGAGG - Intronic
1180843446 22:18969832-18969854 ACGCCCCCCCGGCCCCGCTGGGG + Intergenic
1180852630 22:19029339-19029361 CCCGAGACCCGGCCCTGCCGGGG + Intergenic
1181029641 22:20143596-20143618 CCGGGGCCCCGGCCCAGCAGTGG + Exonic
1181902675 22:26169311-26169333 TGGCACCCCCGGCGCCGCCGCGG + Intergenic
1183370229 22:37427815-37427837 GCGGACCCCTGTCCCGGCCGCGG + Intergenic
1183546204 22:38455804-38455826 TCGGACCCCGGCCCCCGCCTTGG + Intergenic
1183654379 22:39176388-39176410 CAGGGCCCCCGGCAGCGCCGAGG - Intergenic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1183780296 22:39994998-39995020 CCCTGGCCCCGGCCCCGCCGCGG - Exonic
1184037748 22:41926536-41926558 CCCGACCCCCGGGGGCGCCGAGG - Intronic
1184766897 22:46576970-46576992 GCGGACCCCCGAGCCGGCCGCGG + Intronic
1185038079 22:48489947-48489969 CTGGAGCCCGGGCCCTGCCGGGG - Intronic
1185042818 22:48514128-48514150 CTGCACCCCAGGCCCGGCCGCGG + Intronic
1185335810 22:50270417-50270439 CGGGCCTCCCGGCCCCGCCCCGG - Intronic
1185386138 22:50532017-50532039 CCGGCCCCGCGGCCCCATCGCGG - Exonic
1203253340 22_KI270733v1_random:128170-128192 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1203261394 22_KI270733v1_random:173248-173270 CCGGACGACGGGCCCCGGCGGGG - Intergenic
949351222 3:3126774-3126796 CCGGTTTCCCAGCCCCGCCGAGG - Intergenic
950400970 3:12768923-12768945 CCGCCCCCCCCGCCCCGCCCCGG - Intronic
951333526 3:21393844-21393866 CCGGCCCCCCAGCCCCTCTGGGG - Intergenic
951640425 3:24829554-24829576 CCCAGCCCCCGGCCCCGCCGCGG - Intergenic
954401264 3:50321107-50321129 CCGGGCGGCCGGCGCCGCCGTGG - Exonic
954437359 3:50503289-50503311 CCGGGCCCCCGCGCCCGCTGTGG - Exonic
954468870 3:50674949-50674971 CCCGGCTCCCGGCGCCGCCGCGG - Intergenic
956414538 3:69013163-69013185 CCGGACCCCGGGCGCCGCCAGGG + Intronic
956420232 3:69080016-69080038 CCAGCCCCCCGGGCCCGCTGCGG + Intronic
961780068 3:129316027-129316049 CCCGGCCCCAGGCCCGGCCGCGG - Exonic
963091586 3:141487532-141487554 CCGCGCCCCCGGCCGCGCCCCGG - Intronic
963673481 3:148280654-148280676 CCTGAGCCTCGCCCCCGCCGTGG - Intergenic
966496837 3:180590594-180590616 CCGGTGCCCCGGCCCTGCAGCGG + Intergenic
966696247 3:182793430-182793452 CCGGCCCCCCGGCTCCACCCGGG - Intergenic
967871297 3:194232014-194232036 ACTGGCCCCCGCCCCCGCCGAGG + Intergenic
968090371 3:195895345-195895367 CCGCAGCCCCCGCCCCGCAGCGG + Exonic
968489234 4:881200-881222 CCGGCCCCGTGGCCCCACCGTGG - Intronic
968514804 4:1011584-1011606 CCGGACCCCCGACCCGCCCCCGG - Intronic
968756127 4:2417507-2417529 CCGCACCTCCCGCCCCGCCGAGG + Intronic
969113953 4:4859989-4860011 CCAGGCCCCCAGCGCCGCCGCGG + Exonic
969393988 4:6909299-6909321 CCGGAGCTCAGGCCCCGCCGCGG - Intronic
969597682 4:8158330-8158352 CCGGACCCCAGGCCCCCGCGCGG + Intronic
969619065 4:8269881-8269903 CCCGGCGCCCGGCCCCGCAGCGG + Exonic
969865575 4:10075043-10075065 CAGAGCCCCTGGCCCCGCCGCGG - Exonic
976765501 4:88593214-88593236 CCTCGCCCCCGGCCCCGCCCAGG - Intronic
978998012 4:115179518-115179540 CTGAGCCCCCGCCCCCGCCGTGG - Intergenic
982288715 4:153759685-153759707 CAAGACCCCGGGCCCCACCGGGG - Intronic
983577159 4:169271452-169271474 CAGGGCTCCCAGCCCCGCCGGGG - Intergenic
984734947 4:183099675-183099697 CCGGAGACCCGGCCGCGCGGGGG + Intronic
984928322 4:184825858-184825880 CCGGGGCCCGGGCACCGCCGCGG + Intronic
985640682 5:1062160-1062182 CCGCACCCCCAGCCCCTCCGTGG - Intronic
985660793 5:1155752-1155774 CCGGGCCCCCGACCCCGGCCTGG - Intergenic
985749778 5:1667460-1667482 CAGGACCGCGGGCGCCGCCGGGG + Intergenic
987050468 5:14143761-14143783 CGCGTCCTCCGGCCCCGCCGCGG + Exonic
991769181 5:70025216-70025238 TCGGAGCCCCGGCCCAGCCCCGG + Intergenic
991848476 5:70900634-70900656 TCGGAGCCCCGGCCCAGCCCCGG + Intergenic
992627552 5:78648873-78648895 CCGGACGCCCGGCCCGCTCGCGG - Intronic
993386348 5:87267762-87267784 CCGGCCCCCCGCCCCCGCTCCGG + Intergenic
999721154 5:154400197-154400219 CCTCACCCCCGCCCCCGCCATGG - Intronic
1002193837 5:177491907-177491929 CCAGGCCTCCGCCCCCGCCGCGG - Exonic
1003098025 6:3157372-3157394 CCCAACCCCGGGCCCCTCCGTGG + Intronic
1003178507 6:3771864-3771886 CCTGAGTCCCCGCCCCGCCGCGG + Intergenic
1006127984 6:31852289-31852311 CCTGAGCCCCAACCCCGCCGTGG + Intergenic
1006256005 6:32832771-32832793 CCGCACCACCTGCCCCGCCCTGG + Exonic
1006317208 6:33297986-33298008 CCCGCCCCCCCGCCCCGCCCCGG - Intronic
1006706348 6:36024510-36024532 CCGCACTCCCGCCCCCGCCAAGG - Exonic
1007589814 6:43014313-43014335 GAGGACCCGCGGCCCCGCCCCGG + Exonic
1007784127 6:44270602-44270624 CCGGGCCCCCTCCCCCGGCGGGG + Exonic
1007784302 6:44271068-44271090 CCTGAGCCCCGCCCCCGGCGCGG - Intronic
1012912865 6:105137087-105137109 CCGGACCCGCCGACCCGCCGAGG - Exonic
1016010831 6:139135785-139135807 CCCGCCCCTCCGCCCCGCCGCGG + Intronic
1017163779 6:151390283-151390305 CCGCGCCCCCGGCCCCGCCCCGG - Intronic
1017738121 6:157381640-157381662 CCGGCTCCCCGGCCGCGCCTCGG - Exonic
1018046447 6:159969713-159969735 CCGGACGCCCGGCCGCGCGAGGG - Intronic
1018652898 6:166006133-166006155 CCGGGCCCCCCGCCCGCCCGCGG + Intergenic
1018876774 6:167827573-167827595 CCGCGCCCCCCGCGCCGCCGGGG - Intronic
1019271129 7:149846-149868 CAGGTCCCGCGTCCCCGCCGAGG - Intergenic
1019474391 7:1236872-1236894 TCGGCCTCCCAGCCCCGCCGAGG + Exonic
1019536173 7:1530929-1530951 CCCGGTCCCCGTCCCCGCCGCGG - Intronic
1020313828 7:6890218-6890240 TCGCACCCCCGGCCCCACTGTGG - Intergenic
1022207580 7:28179721-28179743 CCGCGTCCCCGGCCCCGCCCGGG + Intronic
1024579846 7:50793019-50793041 CCGGCGCCCCGGGCCCGCAGCGG - Intronic
1028622244 7:92836793-92836815 ACGAGCCCCCAGCCCCGCCGGGG - Intergenic
1029098420 7:98107291-98107313 CCGCAGCCCCGTCCCCGCCGCGG - Intronic
1029110549 7:98211364-98211386 CCCGGACCCCGGCCCCGCCCCGG + Intergenic
1033299812 7:140176335-140176357 CCGGAGCCCCGGGCGCGGCGGGG + Intronic
1034981900 7:155484565-155484587 CCTGAACCCCGGCCCCTCCATGG + Intronic
1037826796 8:22164842-22164864 GCCGAGCCCCCGCCCCGCCGCGG - Exonic
1038444359 8:27593072-27593094 CCGCCCCCCCGGCCCCGCGCAGG - Intergenic
1038613069 8:29071574-29071596 CCAGACCCCCGGCACCACCCTGG + Intronic
1042591674 8:70403304-70403326 CCGCACCCCCGGCCGCGCCTCGG + Intronic
1049218419 8:141418058-141418080 CCGGGACCCCAGCCCCGCCGGGG + Intronic
1049544067 8:143221437-143221459 CCGCACCCCCGGCCCTCCCCAGG - Intergenic
1049707557 8:144049922-144049944 CCGAACCCCCGCCCCCTCTGCGG - Intergenic
1049718556 8:144105016-144105038 GCGGTCCCTCGGCCCCGCTGGGG - Intronic
1049784570 8:144444304-144444326 CCCGGCCCCGGACCCCGCCGCGG - Intronic
1050230900 9:3525526-3525548 CCACACCCCCGACCCAGCCGCGG + Intronic
1051170630 9:14315521-14315543 CCGCAGCCCCGGGCGCGCCGCGG - Intronic
1053066263 9:35071822-35071844 CCCGACCCCGGGCTCCGCCTCGG + Intronic
1053129205 9:35605638-35605660 CCGGGCCCAGGGCCCCGCAGTGG - Exonic
1053306207 9:36986339-36986361 CTGCGCCCCGGGCCCCGCCGCGG + Intronic
1053393466 9:37752196-37752218 CCCCACCCCCACCCCCGCCGTGG + Intronic
1053435011 9:38068730-38068752 TCGGCGCCCCGGCCCCGGCGGGG + Exonic
1056385555 9:86094028-86094050 CCGGACTCCAGGCTGCGCCGGGG - Intronic
1057076879 9:92142516-92142538 CCGCACCCCCAGCCCCGCTCTGG + Intergenic
1058053250 9:100427142-100427164 CCGGTCCGTCGGCGCCGCCGAGG - Intronic
1060103256 9:120857916-120857938 CAGGACCCCTGGCACCCCCGGGG + Exonic
1060114373 9:120928913-120928935 CGGGCGCCCCGGCCCCGCAGGGG - Intronic
1060200936 9:121651558-121651580 CGGGTCCCCAGCCCCCGCCGCGG + Intronic
1060555384 9:124504989-124505011 GCCGGCCCCCGGCCCCGGCGCGG - Intronic
1060814321 9:126626776-126626798 CCCCACCCCCAGCCCCGCGGCGG + Intronic
1060979940 9:127786055-127786077 CCGCACTCCAGGCCCCTCCGCGG - Exonic
1061153975 9:128846042-128846064 CAGGACCCCGGGACCCTCCGAGG - Intronic
1061275824 9:129568976-129568998 GCGGCCCCGCGGCCCCACCGAGG + Intergenic
1061588261 9:131582566-131582588 CCAGGCCCCCAGCCCCGCCTGGG - Intronic
1061610111 9:131740234-131740256 CCAGGCCCCAGGCCCCGGCGTGG - Intergenic
1061766372 9:132884100-132884122 CCCGACCCCCACCCCGGCCGAGG + Intronic
1062269476 9:135702041-135702063 CCGCACCCCCGTCCCAGCCTGGG + Intergenic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062346726 9:136118497-136118519 CCGGGACGCCGGCGCCGCCGCGG - Exonic
1062386007 9:136311819-136311841 CCGGCCCCCCAGCCCTGCTGTGG + Intergenic
1062482266 9:136757996-136758018 CCGGAGCCCGGACCCCGCCACGG - Exonic
1062562528 9:137147986-137148008 CCCGGCCCCCAGCCCCGCCCCGG + Intronic
1062629787 9:137458608-137458630 CCGGACCCCCGGCTCTTGCGCGG - Intronic
1062738178 9:138150198-138150220 CCCAAGCCCCGGCCCCTCCGGGG - Intergenic
1203469740 Un_GL000220v1:111317-111339 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1203477561 Un_GL000220v1:155289-155311 CCGGACGACGGGCCCCGGCGGGG - Intergenic
1185505358 X:629680-629702 TGGGTCCCCAGGCCCCGCCGGGG + Intronic
1185610835 X:1392818-1392840 CGGAACCCCCAGCCCCGGCGCGG - Intergenic
1188004080 X:25005479-25005501 CCGGGCCACCCGCGCCGCCGCGG + Intronic
1188005450 X:25013361-25013383 CCGGGCCGCCGGCCACGCCGAGG + Exonic
1191184224 X:57592516-57592538 CTCCGCCCCCGGCCCCGCCGCGG + Exonic
1191213169 X:57909943-57909965 CTCCGCCCCCGGCCCCGCCGCGG - Exonic
1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG + Exonic
1196965119 X:121047445-121047467 CCGGGGCGCCGGACCCGCCGCGG - Intergenic
1200100949 X:153688890-153688912 CCCGACCCCCGGAGCCGCCGCGG + Intronic
1200155042 X:153970737-153970759 CCGGTGCCACGGCCCCGCCACGG - Exonic
1200181625 X:154154504-154154526 CAGGACCCCCGGCCCAGGCACGG - Intronic
1200187273 X:154191618-154191640 CAGGACCCCCGGCCCAGGCACGG - Intergenic
1200192922 X:154228758-154228780 CAGGACCCCCGGCCCAGGCACGG - Intronic
1200198677 X:154266562-154266584 CAGGACCCCCGGCCCAGGCACGG - Intronic
1200267304 X:154653266-154653288 CCGGCCTCCTGGCCCCGCAGGGG + Exonic