ID: 1129348518

View in Genome Browser
Species Human (GRCh38)
Location 15:74939727-74939749
Sequence GCAAGAGACAAGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129348518_1129348521 -4 Left 1129348518 15:74939727-74939749 CCTTCTGCCCTCTTGTCTCTTGC No data
Right 1129348521 15:74939746-74939768 TTGCCCCTTACTCTCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129348518 Original CRISPR GCAAGAGACAAGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr