ID: 1129350780

View in Genome Browser
Species Human (GRCh38)
Location 15:74955023-74955045
Sequence GTACATCGCCACTAAGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129350780_1129350794 21 Left 1129350780 15:74955023-74955045 CCTTTCCCTTAGTGGCGATGTAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1129350794 15:74955067-74955089 TGCAACAGCCTCTGAGGCCAGGG 0: 1
1: 0
2: 3
3: 18
4: 252
1129350780_1129350791 15 Left 1129350780 15:74955023-74955045 CCTTTCCCTTAGTGGCGATGTAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1129350791 15:74955061-74955083 CCCATTTGCAACAGCCTCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1129350780_1129350796 30 Left 1129350780 15:74955023-74955045 CCTTTCCCTTAGTGGCGATGTAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1129350796 15:74955076-74955098 CTCTGAGGCCAGGGCCAGCCCGG 0: 1
1: 1
2: 9
3: 67
4: 665
1129350780_1129350787 -10 Left 1129350780 15:74955023-74955045 CCTTTCCCTTAGTGGCGATGTAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1129350787 15:74955036-74955058 GGCGATGTACAGGGGTACACGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1129350780_1129350793 20 Left 1129350780 15:74955023-74955045 CCTTTCCCTTAGTGGCGATGTAC 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1129350793 15:74955066-74955088 TTGCAACAGCCTCTGAGGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129350780 Original CRISPR GTACATCGCCACTAAGGGAA AGG (reversed) Exonic
911908587 1:103601316-103601338 GTACATAGCCAGTAATGGGATGG + Intergenic
918111347 1:181457854-181457876 GTACATTCCCACTATGGGACAGG + Intronic
918809019 1:189091871-189091893 GTACATACCCAGTAATGGAATGG + Intergenic
1064359773 10:14653629-14653651 GTGCATTGCCACCAAGGAAATGG - Intronic
1065192755 10:23229069-23229091 GTATATAGCCAGTAATGGAATGG - Intronic
1073094293 10:100970259-100970281 GTACTTCGCCACTGAAGGGAGGG + Intronic
1081770539 11:45648056-45648078 CTAGATTGCCACGAAGGGAAGGG + Intergenic
1088403847 11:109450245-109450267 GTACATACCCAGTAAGGGGATGG - Intergenic
1089391557 11:118105606-118105628 GGACATCATCTCTAAGGGAAGGG + Intronic
1091659638 12:2373762-2373784 TTTAATCGCCACTAATGGAAAGG - Intronic
1100996739 12:100308950-100308972 GTACATCCCCAGTAAGGGACTGG + Intronic
1101737583 12:107474584-107474606 GTAGTTGGCCACAAAGGGAAGGG + Intronic
1104591319 12:130086308-130086330 CTTCCTCGCCACCAAGGGAAGGG + Intergenic
1112520061 13:100087286-100087308 GTACATGGCCACCCAGCGAAAGG - Intergenic
1118600895 14:67470927-67470949 GTCCCTGGCCACTAAGGGATTGG + Exonic
1120208089 14:81607876-81607898 CTCCACCGCCACTAATGGAAAGG + Intergenic
1123098030 14:105775560-105775582 GTACCTCGCCACAACAGGAAGGG - Intergenic
1125057072 15:35373178-35373200 GTACATAAGCATTAAGGGAAGGG - Intronic
1129350780 15:74955023-74955045 GTACATCGCCACTAAGGGAAAGG - Exonic
1131995850 15:98132073-98132095 CTACATGGCCACTAGGAGAAAGG - Intergenic
1156011973 18:32506585-32506607 GGACATTGCCTCTAAGGTAAGGG - Intergenic
1156070001 18:33195814-33195836 GTACATTTCCAGTAGGGGAAAGG - Intronic
1156777589 18:40811545-40811567 GTCCATGGCCACTAAGGCATTGG - Intergenic
926658581 2:15438556-15438578 GGATAACGACACTAAGGGAAGGG + Intronic
931380699 2:61750597-61750619 TTACATTTCCACTGAGGGAAGGG + Intergenic
934302291 2:91784467-91784489 GTATATACCCAGTAAGGGAATGG - Intergenic
939786148 2:146515645-146515667 GTACATTTCCCCTATGGGAAAGG + Intergenic
948011723 2:234654151-234654173 ACACATCGCAACTAAGAGAAGGG - Intergenic
948619948 2:239228021-239228043 GGACATTGCCACAAAGGGATGGG + Intronic
1170798276 20:19569323-19569345 GTACATCGGCAGTGAGGGCAAGG + Intronic
1180933194 22:19607339-19607361 GTGCATCGGCACCAAGGGCAGGG - Intergenic
955556081 3:60138972-60138994 GTACCTGGCCACTCAGTGAAGGG - Intronic
968749964 4:2383532-2383554 GTGCGCTGCCACTAAGGGAAAGG - Intronic
969563618 4:7964890-7964912 ATACCTCCCCAGTAAGGGAAGGG - Intergenic
979550012 4:121979941-121979963 GCACAGCCCCACTAAAGGAAAGG + Intergenic
981830200 4:148990672-148990694 GTACATTTCCTCTAAAGGAAAGG - Intergenic
993008262 5:82451744-82451766 GTATATACCCACTAATGGAATGG + Intergenic
1012449265 6:99338052-99338074 ACAAATCCCCACTAAGGGAATGG + Intronic
1021506577 7:21391943-21391965 GTAGATCACCACTGAGGCAAAGG + Intergenic
1025582439 7:62737301-62737323 GTATATACCCACTAATGGAATGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030708165 7:112716775-112716797 GTATATAGCCAGTAATGGAATGG + Intergenic
1034724131 7:153319590-153319612 GTACATGGCCTGTCAGGGAATGG - Intergenic
1034829111 7:154294043-154294065 GCACATAGCCAGTAAGCGAAAGG + Intronic
1045159274 8:99519437-99519459 GTACATCCCCAGTAATGGGACGG - Intronic
1048288080 8:133157979-133158001 GAGCAATGCCACTAAGGGAATGG - Intergenic
1051874610 9:21778077-21778099 TTCCATCGCCTCTAAAGGAAAGG + Intergenic
1057091162 9:92259282-92259304 GTACACCAGCACTAAGAGAAAGG + Intronic
1186048392 X:5561985-5562007 GGACAAAGCCACTAAGTGAATGG - Intergenic
1191808226 X:65158278-65158300 GTATATAGCCAGTAATGGAATGG + Intergenic
1198592919 X:138203908-138203930 GTACATACCCAGTAATGGAATGG - Intergenic