ID: 1129355255

View in Genome Browser
Species Human (GRCh38)
Location 15:74986544-74986566
Sequence GCCTTAGGAGGGGCCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129355244_1129355255 19 Left 1129355244 15:74986502-74986524 CCAAGCCCAGGAGAGGGTGTGAG 0: 1
1: 0
2: 4
3: 47
4: 371
Right 1129355255 15:74986544-74986566 GCCTTAGGAGGGGCCTGAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 185
1129355245_1129355255 14 Left 1129355245 15:74986507-74986529 CCCAGGAGAGGGTGTGAGTTCTT 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1129355255 15:74986544-74986566 GCCTTAGGAGGGGCCTGAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 185
1129355246_1129355255 13 Left 1129355246 15:74986508-74986530 CCAGGAGAGGGTGTGAGTTCTTA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1129355255 15:74986544-74986566 GCCTTAGGAGGGGCCTGAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129355255 Original CRISPR GCCTTAGGAGGGGCCTGAGT AGG Intronic
900151993 1:1182813-1182835 GCCCTAGGAGGGGCGTGGCTGGG + Intronic
900401998 1:2476434-2476456 GGCTTCGGAGGGCCCTGAGGAGG + Exonic
901134168 1:6982465-6982487 GCGGGAGGAGGGGCCAGAGTGGG + Intronic
901858229 1:12057707-12057729 GCCATAGCAGGGGCCTGGATAGG + Intergenic
901885270 1:12218321-12218343 GTCATGGGAGGGGCCTGAGCTGG + Intergenic
902884744 1:19396520-19396542 GCTTTAGGAGGAGCCTGTGTAGG - Intronic
903831390 1:26177451-26177473 GCCTAAGGAGGGGCCGGGCTGGG - Exonic
904819425 1:33231826-33231848 GCCTTAGAAGCTGCCTTAGTAGG - Intergenic
907331757 1:53676354-53676376 GACTGAGGAGGAGACTGAGTTGG - Intronic
908339238 1:63159430-63159452 GCCTTTGGAGGGGCTGGGGTGGG + Intergenic
908854310 1:68407123-68407145 GCCTTAGGAGGAGTCCCAGTGGG - Intergenic
912121796 1:106480230-106480252 GATTTAGGAGGGGCCAGGGTAGG + Intergenic
914758476 1:150579800-150579822 GCCTGAGCCGGGGCCTGAGCGGG + Intergenic
915384890 1:155481557-155481579 GCCTTAAGCGGTTCCTGAGTGGG + Exonic
915752476 1:158224505-158224527 GATTTGGGAGGGGCCAGAGTTGG + Intergenic
916036853 1:160929835-160929857 GCCTTCAGAGAGGTCTGAGTAGG - Intergenic
919897572 1:202018662-202018684 GCCTGAGGAGGGGCTGGGGTTGG + Intergenic
920418923 1:205817197-205817219 GCCTGTGGAGGAGCCTGTGTGGG + Intergenic
922988633 1:229886311-229886333 GCCTTAGGTGCAGCCTGCGTGGG + Intergenic
923092977 1:230753667-230753689 GACTGAGGAGGGGCCTGGGCTGG - Intronic
923454088 1:234147957-234147979 GCCTTAGGGAGGGCCACAGTGGG + Intronic
1065528176 10:26643312-26643334 GCCCTGTGAGGGCCCTGAGTGGG - Intergenic
1066351748 10:34642520-34642542 GGCTTAGGAGAGGCCTGGGGAGG - Intronic
1066995451 10:42559089-42559111 GCCTTTGAAGTGGCCTGAGACGG + Intergenic
1067791991 10:49295372-49295394 GCCTGCTGAGGGGCCTGAGCCGG - Intergenic
1068121338 10:52784868-52784890 GGCTTTGCAGGGTCCTGAGTGGG + Intergenic
1069633980 10:69914227-69914249 GCTCTAGGAGGGGTCTCAGTGGG - Intronic
1070151810 10:73810051-73810073 GCCTTACAAGGAGGCTGAGTGGG - Intronic
1073774003 10:106766109-106766131 TCCTTAGGAGGCGCCTGTGTTGG + Intronic
1074118523 10:110476067-110476089 GTCTTGGGTGGGGCCTGAGCTGG - Intergenic
1076903214 10:133350074-133350096 GCCTGAGGGGGGGCCAGAGAGGG - Exonic
1076995800 11:296986-297008 GCCTCAGGATTGGCCTGAGAAGG - Intergenic
1077190699 11:1254952-1254974 GCCTGGGGAGGGGAATGAGTGGG + Intronic
1080666674 11:34342442-34342464 TCCTCAGGAGTGGCCTGGGTGGG - Intronic
1080777973 11:35403994-35404016 GCCTTAGGAGGCGCCCGTGGAGG - Intronic
1080889376 11:36396223-36396245 GCCTGAGCAGGCGCCTGACTTGG - Intronic
1080897579 11:36459235-36459257 GCCTCAAGAGGAGCATGAGTTGG + Intronic
1081958917 11:47119142-47119164 GCCTTTGGTGAGGCTTGAGTAGG - Intronic
1084572084 11:69965978-69966000 GCCTGGGGAGGGGCCTGGGGAGG - Intergenic
1084752917 11:71215652-71215674 ACATTAGCAGGGCCCTGAGTGGG - Intronic
1087216930 11:95504642-95504664 TCCTTAGGAGGGGTGTGAGGAGG + Intergenic
1088764620 11:112963063-112963085 GCCGTGGGAGGGACCCGAGTTGG - Intronic
1089492462 11:118892513-118892535 GCCTGGGGAGGGGCTTGGGTAGG + Intronic
1089678787 11:120108041-120108063 GCCTGAGGAGGGGGCTGGGTGGG - Intergenic
1092406086 12:8223077-8223099 GCCTTCGGAAGGGCATCAGTCGG - Intronic
1096587232 12:52630639-52630661 GCCTTTGGAGGGGGGAGAGTGGG - Intergenic
1099427014 12:82535809-82535831 GTCATAGGAGGTGCCTGAGTGGG + Intergenic
1099776445 12:87137630-87137652 GCCTTGGGAGGGGTCTGTGCAGG + Intergenic
1102222718 12:111205229-111205251 GCCTTCAGAGGGGCCTCAGAGGG - Intronic
1102768794 12:115455301-115455323 GCCGCAGGAGGGGCCTGCGATGG + Intergenic
1103009365 12:117446525-117446547 CCCTTAGGAGAGGCTAGAGTAGG - Intronic
1104467675 12:129003983-129004005 GCCATAGGAGAGGTCTAAGTAGG + Intergenic
1104810253 12:131616251-131616273 GGCTTTGGAGGGGGCTGAGAAGG - Intergenic
1107353065 13:39536490-39536512 GCGTTAGGAGAGCCATGAGTTGG - Intronic
1107395469 13:40012030-40012052 TCTTTTGGTGGGGCCTGAGTGGG + Intergenic
1107755328 13:43615435-43615457 TCCTTGGAAGGGGCCTGTGTGGG - Intronic
1110672306 13:78195103-78195125 GCCCCAGCAGGGGGCTGAGTTGG - Intergenic
1112744311 13:102509487-102509509 GACTTAGGAGGGGCCAGGGATGG + Intergenic
1118485209 14:66208109-66208131 CCCTTAGGAGGGGCTGGAGAGGG - Intergenic
1121325560 14:93017689-93017711 GCCTTAGCAGAGGCCAGAGAAGG + Intronic
1121429038 14:93873970-93873992 GCCTCAGGAGGGGGCAGAGCTGG - Intergenic
1122145099 14:99684242-99684264 GCCCTGGGAGGGGTCGGAGTCGG + Intergenic
1122940134 14:104977522-104977544 GCCTGGTGAGGGGCCTGAATGGG - Intronic
1123021450 14:105399586-105399608 GCCTCAGGGGAGGGCTGAGTGGG + Intronic
1126888989 15:53183687-53183709 GCCTTTGCTGGGGCTTGAGTAGG + Intergenic
1127770365 15:62225739-62225761 GCATTAGGAGGGGCCCCAGAAGG - Intergenic
1129034890 15:72642929-72642951 GCCTGAGTTGGGGGCTGAGTGGG + Intergenic
1129214992 15:74094287-74094309 GCCTGAGTTGGGGGCTGAGTGGG - Intergenic
1129355255 15:74986544-74986566 GCCTTAGGAGGGGCCTGAGTAGG + Intronic
1129390375 15:75217312-75217334 GCCTGAGTTGGGGGCTGAGTAGG + Intergenic
1129732136 15:77938649-77938671 GCCTGAGTTGGGGGCTGAGTGGG - Intergenic
1129868778 15:78928010-78928032 GCCTGAGGAGGGGCCTCACCCGG + Intronic
1131357711 15:91760071-91760093 GACTTAAGAAGGGCCTGAGAAGG + Intergenic
1132515006 16:362179-362201 GCCTCGGGAGGGGCCTCAGGGGG - Intergenic
1132621363 16:869691-869713 GCCTTAGGAGGGGCCTCATGTGG - Intronic
1132752294 16:1464348-1464370 GCTTTGGGAGGGGCAGGAGTTGG - Intronic
1132811330 16:1799374-1799396 GGTTTAGGAGGGGCCAGAGGTGG + Intronic
1133328717 16:4958191-4958213 GCCTGGGGCGGGGCCAGAGTGGG + Intronic
1140406215 16:74713408-74713430 GCCCGAGTAGGGGCCTGAGCGGG + Exonic
1141810390 16:86371909-86371931 GCCTCAGGAGGGGCCAGGATGGG - Intergenic
1141840996 16:86573944-86573966 ATCTTAGTAAGGGCCTGAGTTGG - Intergenic
1142358099 16:89613596-89613618 TCCTGAGGAGGGGCCTGGGAGGG + Intronic
1144740508 17:17579700-17579722 CCCTTAGGAGGGGCCTGCATTGG - Intronic
1145937086 17:28720703-28720725 GCTTTAGGAGGGGCAGGAGCTGG - Exonic
1152440844 17:80308537-80308559 GACTTAGGAGGAGCCTTAGGAGG - Intronic
1153274821 18:3358064-3358086 GCCTAAGGAGGACCCTGAGTGGG + Intergenic
1153631046 18:7069882-7069904 GATTTAGGAAAGGCCTGAGTGGG - Intronic
1154156470 18:11947944-11947966 GCATCAGGGGGGGCCTGGGTGGG - Intergenic
1155514942 18:26615196-26615218 GCCTCAGGACTGGGCTGAGTTGG - Intronic
1160686379 19:438824-438846 GCCTTGTTGGGGGCCTGAGTTGG + Exonic
1160743610 19:699497-699519 CCCTGAGGAGGGGGCTGAGTGGG + Intergenic
1160972219 19:1774699-1774721 GGCTTGGGGGGTGCCTGAGTGGG + Intronic
1162199486 19:9010302-9010324 GCGCTAGCAGGGGCCTGCGTCGG + Intergenic
1163630465 19:18415659-18415681 GCCAAAGGAGGAGCCTCAGTAGG + Intergenic
1164542446 19:29131013-29131035 GCCCTAGGAAGGGCCTGGGCTGG + Intergenic
1165678985 19:37757097-37757119 GCCTTAAGAGGGGATTGTGTTGG - Intronic
1167277872 19:48549915-48549937 GCCTGAGGTTGTGCCTGAGTGGG - Intergenic
925017779 2:544799-544821 GCCTCAGGAGGGGCCTCAGGAGG - Intergenic
925293819 2:2765204-2765226 TCCCTAGCAGAGGCCTGAGTTGG + Intergenic
926992046 2:18690451-18690473 GCTGTAGAAGGGGTCTGAGTAGG - Intergenic
927862844 2:26570898-26570920 GGCTAAGGAGGGGCCTAAGCAGG + Intronic
928688255 2:33772539-33772561 GCCTTAGGTGGGGTGTGAGTGGG + Intergenic
931759436 2:65403693-65403715 GCCTGGGGTGGGGCCTGAGATGG - Intronic
932417052 2:71579923-71579945 ACCTTGGAAGAGGCCTGAGTGGG + Intronic
934687736 2:96333968-96333990 GCCTGAGGGGGGGCCAGAGCAGG + Intergenic
937156744 2:119725178-119725200 GGCTTAGAAGCGGCCTGAGGAGG + Intergenic
938160952 2:128983911-128983933 ACCTTTGGAGAGACCTGAGTGGG - Intergenic
938544392 2:132314654-132314676 GACTTGGGAGGGGCCGGGGTGGG - Intergenic
939770752 2:146313897-146313919 GTCTTAGGAAGGTCCTGAATTGG - Intergenic
944632938 2:201645251-201645273 GGCTCAGGAGGAGCCTCAGTGGG - Exonic
945275537 2:207983958-207983980 GCCTGAGGAGGGACGTGAGAGGG - Intronic
1170252151 20:14295546-14295568 TCATTAGGAGGGGACTGTGTGGG + Intronic
1173954267 20:47018575-47018597 GCCACAGGAGGGGCCAGAGCTGG + Intronic
1174311608 20:49660048-49660070 CACATAGAAGGGGCCTGAGTGGG - Intronic
1174963027 20:55179171-55179193 ACCTTAGTAGGGACCTGAGAAGG + Intergenic
1175516743 20:59575033-59575055 TCCTTAGGTGTGGCCTGGGTTGG - Intergenic
1175720050 20:61280366-61280388 GCCTTGGGAGGCGCCAGAGAGGG - Intronic
1176032027 20:63017334-63017356 GCCTCAGGAGAGCCCTCAGTGGG + Intergenic
1176059752 20:63167472-63167494 GGCTGAGGAGGGGGCTGAGGTGG - Intergenic
1177653169 21:23983666-23983688 GGCTTAGTAGGGGCCTGGGCTGG + Intergenic
1178392643 21:32211916-32211938 GCCTGGGGAGAGGCCTGAGAGGG - Intergenic
1179437942 21:41374901-41374923 GCCTTTGGAGGGTTCTGAGCTGG - Intronic
1179922601 21:44515326-44515348 GCCTTAGGAGGGCCCTGGGAAGG - Intronic
1180080195 21:45483203-45483225 GCCTGGGGAGGGCCCTGAGCTGG + Intronic
1183185429 22:36289038-36289060 GTCTTGGGAAGGGCCCGAGTGGG - Intronic
1184995714 22:48205946-48205968 GCCTTAGGAGGGGACACACTGGG + Intergenic
949275166 3:2270763-2270785 TCCTTTGGAGGGTCCTGAGAGGG + Intronic
950104651 3:10380350-10380372 CCCTTGGGAGGGGTCTGAGAAGG + Intronic
950726046 3:14917610-14917632 GCATAAGGAAGGGCCTGGGTTGG + Intronic
951180523 3:19653928-19653950 GATTTAGGAGGGGCCTGGGGTGG - Intergenic
953188815 3:40664326-40664348 GCCTTAGGTGAGGACTGAGATGG - Intergenic
953881766 3:46694547-46694569 TCCTCAGTAGGGGGCTGAGTAGG - Intergenic
960412362 3:117342901-117342923 GCCCTGGGAGTGGCCAGAGTGGG - Intergenic
965319408 3:167233243-167233265 GCCTAAGGAGGGCCCAGAGTTGG - Intergenic
965551250 3:169967008-169967030 GCGTTGTGAGGGGCCTGAGGGGG + Intronic
968392393 4:204241-204263 GATTTGGGAGGGGCCAGAGTTGG + Intergenic
968829975 4:2928317-2928339 GCCTCAGTAGGGGCCTCAGTGGG - Exonic
969259197 4:6022885-6022907 GCCTTGGGAGAGGTCTGAGCTGG - Intergenic
971962634 4:33508313-33508335 GACTTGAGAGGGGACTGAGTTGG + Intergenic
972744735 4:41922104-41922126 GATTTAGGAGAGGCCAGAGTTGG + Intergenic
978587656 4:110291546-110291568 GCCTGAGGAGCTGCCTGAGGAGG + Intergenic
982567392 4:157002929-157002951 GCCTTAGCAATGGACTGAGTTGG - Intergenic
984854921 4:184186892-184186914 ACCTTTGGAGGGTTCTGAGTAGG - Intronic
985664309 5:1173999-1174021 CCCCTTGGAGGGGCCTGAGGTGG - Intergenic
986179955 5:5384271-5384293 GCCATTGGAGGGCCCTGAGGAGG + Intergenic
986387361 5:7247767-7247789 GCCTGGGGAGGGGCCACAGTGGG + Intergenic
986601659 5:9478866-9478888 GATTTAGGAGGGGCCAGGGTGGG + Intronic
988807057 5:34750306-34750328 GGCTTAGGAGTGGGCTGGGTGGG + Intronic
992426890 5:76666991-76667013 GCTTTAGGAGGAGGCTGAGATGG - Intronic
997225349 5:132205520-132205542 GACTAATGAGGGGCCAGAGTGGG + Intronic
998978719 5:147676652-147676674 GCTGTAGGAGGTGCCTGATTAGG - Intronic
999378795 5:151105474-151105496 GCCTAAGGATGGGCCAGAGGAGG - Intronic
1001334321 5:170784888-170784910 GCCCTAGGAGGCTCCTGAGTAGG - Intronic
1006171310 6:32095037-32095059 GCTCCAGGAGGGGACTGAGTGGG - Intronic
1007145335 6:39624036-39624058 GTGTTAAAAGGGGCCTGAGTAGG + Intronic
1007290015 6:40778485-40778507 GACTTAGGAGGGGACAGAGCTGG + Intergenic
1007748793 6:44059278-44059300 GCCCTAGGAGGGGCCTGTCTGGG - Intergenic
1009527273 6:64763583-64763605 GATTTAGGAGGGGCCAGGGTTGG - Intronic
1012649502 6:101735750-101735772 GATTTAGGAGGGGCCTGGGGAGG - Intronic
1014734221 6:125073386-125073408 GCCTAAGAAGGGGCCTGTGCAGG - Intronic
1015085632 6:129287799-129287821 GCCTTTGGGGGGACCTCAGTTGG - Intronic
1016292128 6:142537822-142537844 TCCTGAGGAGGGGACTGTGTAGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1017811633 6:157988105-157988127 GCCCTGGGAGGGGGCTGAGCAGG - Intronic
1019391122 7:787317-787339 GCCTTGGGGGGTGTCTGAGTTGG + Intergenic
1023150707 7:37199079-37199101 GCCTTAGGAGGGACATTTGTGGG - Intronic
1023402207 7:39798433-39798455 GGCTGAGGAGGGGGCTGAGGAGG - Intergenic
1023929714 7:44697815-44697837 GACTTGGGAAGGGCCTGTGTAGG + Intronic
1024076193 7:45819054-45819076 GGCTGAGGAGGGGGCTGAGGAGG - Intergenic
1024647413 7:51382227-51382249 GGCTGAGGAGGGGGCTGAGGAGG + Intergenic
1025128209 7:56362398-56362420 GGCTGAGGAGGGGGCTGAGGAGG + Intergenic
1025695202 7:63771107-63771129 GGCTGAGGAGGGGGCTGAGGAGG - Intergenic
1026411477 7:70127379-70127401 GCTTTGGGAGGGGGCTGAGGAGG - Intronic
1026479051 7:70763148-70763170 GCCTCAGGAGGGCCCTGTGGTGG - Exonic
1029124528 7:98287301-98287323 GCCTTAGGAGGTGCCGGAGTGGG + Intronic
1030176690 7:106661194-106661216 GCGGTGGGAGGGGCCTGAGGCGG - Intergenic
1032052721 7:128658826-128658848 GGCTGAGGAGGGGGCTGAGGAGG - Intergenic
1032433430 7:131881310-131881332 AGCGTAGGAGGGGCCTGGGTTGG + Intergenic
1032980281 7:137274146-137274168 GCATTAAGAGAGGCCTGAGAAGG + Intronic
1036203304 8:6786993-6787015 GCCTTAGGAGATGCTTGGGTGGG + Intergenic
1049303408 8:141883802-141883824 GGCTTGGGAGGGTCCTGAGGTGG - Intergenic
1050915114 9:11121971-11121993 GACTTGGGAGGGGCCAGGGTTGG - Intergenic
1052362497 9:27575734-27575756 GATTTGGGAGGGGCCAGAGTTGG - Intergenic
1052855058 9:33401944-33401966 CCCTCAGGAGGGGACTGCGTGGG + Intronic
1053683076 9:40498285-40498307 CCCTCAGGAGGGGACTGCGTGGG + Intergenic
1053933059 9:43126601-43126623 CCCTCAGGAGGGGACTGCGTGGG + Intergenic
1054280638 9:63126643-63126665 CCCTCAGGAGGGGACTGCGTGGG - Intergenic
1054296176 9:63333783-63333805 CCCTCAGGAGGGGACTGCGTGGG + Intergenic
1054394192 9:64638288-64638310 CCCTCAGGAGGGGACTGCGTGGG + Intergenic
1054428842 9:65143487-65143509 CCCTCAGGAGGGGACTGCGTGGG + Intergenic
1054501537 9:65878048-65878070 CCCTCAGGAGGGGACTGCGTGGG - Intronic
1056468992 9:86886819-86886841 TCCTTTGGAGAGGCCTGTGTAGG + Intergenic
1056789384 9:89615892-89615914 GCCTTAGGACAGGACTGAGGGGG - Intergenic
1057826759 9:98377746-98377768 TCCAGAGGAGGGGGCTGAGTGGG - Intronic
1060495820 9:124118008-124118030 GGATCAGGAGGGGCCTGCGTGGG + Intergenic
1061908619 9:133711406-133711428 GCAGCAGGAGGGGCCTGAATTGG + Intronic
1062046532 9:134426992-134427014 GCCGTAGGAGGGGCAGGAGTGGG + Intronic
1186193296 X:7086998-7087020 GCCCCAGGAGGGCCCTGAGCTGG - Intronic
1187092014 X:16106833-16106855 GCCCTAGGTGTGGCTTGAGTGGG + Intergenic
1191764894 X:64687200-64687222 GGGTTAGGAGGTGCCTCAGTAGG - Intergenic
1192225554 X:69225096-69225118 ATGTTAGGAGGGGCTTGAGTAGG + Intergenic
1196791501 X:119468738-119468760 GGCTTAGGAGAGGCCAGAGCGGG + Intronic
1197890341 X:131264096-131264118 GCCTTGGGAGGAGGATGAGTGGG + Intergenic