ID: 1129359413

View in Genome Browser
Species Human (GRCh38)
Location 15:75015242-75015264
Sequence CTGAATAAACAAAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1854
Summary {0: 1, 1: 0, 2: 13, 3: 174, 4: 1666}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129359413_1129359418 -10 Left 1129359413 15:75015242-75015264 CCCTCCTTCCTTTGTTTATTCAG 0: 1
1: 0
2: 13
3: 174
4: 1666
Right 1129359418 15:75015255-75015277 GTTTATTCAGCAGGTCTTTGTGG 0: 1
1: 0
2: 2
3: 22
4: 240
1129359413_1129359421 15 Left 1129359413 15:75015242-75015264 CCCTCCTTCCTTTGTTTATTCAG 0: 1
1: 0
2: 13
3: 174
4: 1666
Right 1129359421 15:75015280-75015302 TTAGCTTTGTTTTCAAGGAAGGG 0: 1
1: 0
2: 0
3: 38
4: 387
1129359413_1129359419 10 Left 1129359413 15:75015242-75015264 CCCTCCTTCCTTTGTTTATTCAG 0: 1
1: 0
2: 13
3: 174
4: 1666
Right 1129359419 15:75015275-75015297 TGGACTTAGCTTTGTTTTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 259
1129359413_1129359420 14 Left 1129359413 15:75015242-75015264 CCCTCCTTCCTTTGTTTATTCAG 0: 1
1: 0
2: 13
3: 174
4: 1666
Right 1129359420 15:75015279-75015301 CTTAGCTTTGTTTTCAAGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129359413 Original CRISPR CTGAATAAACAAAGGAAGGA GGG (reversed) Intronic
900863062 1:5246430-5246452 TGGAAGAAACGAAGGAAGGAGGG - Intergenic
901165277 1:7216509-7216531 CGAAAGAAAGAAAGGAAGGAAGG - Intronic
901265020 1:7903356-7903378 ATAATTAAAAAAAGGAAGGAGGG - Intergenic
901681887 1:10917737-10917759 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
901749933 1:11399870-11399892 CTGAATGAAGACAGGAAGGCTGG + Intergenic
901914588 1:12488223-12488245 CTGAATAAAGGTAGGAAAGAGGG + Intronic
902099560 1:13974701-13974723 CTGAGGAAGCAAAGGAAGCAAGG + Intergenic
902586120 1:17439403-17439425 AGGAATAAAAAGAGGAAGGAAGG - Intronic
902765390 1:18611183-18611205 CTGAAAGAAGGAAGGAAGGAAGG + Intergenic
902827601 1:18987742-18987764 ATGAATGAATGAAGGAAGGAAGG + Intergenic
902827602 1:18987746-18987768 ATGAATGAAGGAAGGAAGGAAGG + Intergenic
902949720 1:19872819-19872841 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
903019697 1:20385465-20385487 ATGAATGAATAAAGGAGGGAAGG + Intergenic
903054775 1:20628030-20628052 CTGAATTTCAAAAGGAAGGAAGG - Intergenic
903181387 1:21606668-21606690 CTGAAAAAAACAAGGAAAGAGGG - Intronic
903419137 1:23206040-23206062 CTCAAAAAAAAAAGAAAGGAAGG - Intergenic
903466277 1:23554618-23554640 CTGAAAGAACGAAGGAAGGAAGG + Intergenic
903510243 1:23869217-23869239 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
903623330 1:24713864-24713886 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
903801026 1:25968315-25968337 CTGATTATACACAGGAAGGTGGG + Intronic
904127251 1:28249786-28249808 TTGAATGAAAAAAGGAAGGAAGG + Intergenic
904134905 1:28304589-28304611 CTGTTTCAAAAAAGGAAGGAAGG + Intergenic
904535530 1:31197058-31197080 TGGAAAAAATAAAGGAAGGAGGG - Intronic
904747934 1:32722519-32722541 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
904919604 1:33996740-33996762 CAGAAAAGAAAAAGGAAGGAAGG + Intronic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905080210 1:35312723-35312745 CTGTCTCAAAAAAGGAAGGAAGG - Intronic
905155064 1:35970716-35970738 ATAAATAAACAAAGGGAGGGAGG - Intronic
905501058 1:38437256-38437278 CTCAAAAAATAAAGGCAGGAAGG - Intergenic
905540668 1:38757925-38757947 CTGAATAAATGAAGGAAGGAAGG + Intergenic
905658993 1:39706224-39706246 CTGAAAAAAAGAAGGAAGGAAGG - Intronic
905671505 1:39793612-39793634 CAAAAAAAAAAAAGGAAGGAAGG + Intergenic
905815274 1:40945359-40945381 TGGAATAAACAAAGGAAAGTGGG + Intergenic
905925996 1:41750336-41750358 CTGAATAAACGAGGGAGTGAAGG + Intronic
906174751 1:43761541-43761563 AGGAAAAAACAAAGGAAGAAAGG + Intronic
906561588 1:46762043-46762065 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
906631910 1:47377787-47377809 CTGAATAAAAATAGCAAGGAAGG - Exonic
906692218 1:47800019-47800041 ATGAATGAAGGAAGGAAGGAAGG - Intronic
906692219 1:47800023-47800045 ATGAATGAATGAAGGAAGGAAGG - Intronic
906692220 1:47800027-47800049 CTGAATGAATGAATGAAGGAAGG - Intronic
906701157 1:47859209-47859231 CAGGAAAAAGAAAGGAAGGATGG - Intronic
907141592 1:52190954-52190976 CTGAAGGAAGGAAGGAAGGAAGG - Intronic
907492853 1:54820020-54820042 ATGAATGAAGGAAGGAAGGAAGG - Intronic
907690298 1:56657746-56657768 ATGAATGAAAGAAGGAAGGAAGG + Intronic
907759858 1:57347074-57347096 GTGATTACACAAAGGCAGGAAGG + Intronic
907940617 1:59083873-59083895 ATGAATAAAAAAAGGAAAGAAGG + Intergenic
908116568 1:60946640-60946662 CTGCATGAACAAAGGAAGAGAGG + Intronic
908127369 1:61044366-61044388 CTGAGTAAACAAATCAAGGATGG + Intronic
908165024 1:61449347-61449369 TTAAATAAATAAAGGAGGGAAGG - Intronic
908187771 1:61668968-61668990 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
908218357 1:61978243-61978265 AAGAATAAAGGAAGGAAGGAGGG - Intronic
908224913 1:62046198-62046220 AAGAAAAAAGAAAGGAAGGAAGG + Intronic
908492080 1:64655241-64655263 ATGAAAAGTCAAAGGAAGGAAGG - Intronic
908746560 1:67382213-67382235 CTCAATTAAAAAAGAAAGGAAGG + Intronic
908843432 1:68300811-68300833 ATGAAAAAAGGAAGGAAGGAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909142489 1:71886462-71886484 AAAAAAAAACAAAGGAAGGAAGG + Intronic
909186463 1:72492563-72492585 ATAAATAAATAAAAGAAGGAAGG + Intergenic
909217766 1:72912867-72912889 CTGAATAAATAAAGTAATCAAGG - Intergenic
909767590 1:79376526-79376548 CAGAAAAAAGGAAGGAAGGAAGG + Intergenic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
910017990 1:82550906-82550928 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
910017995 1:82550938-82550960 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
910051299 1:82977489-82977511 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
910140119 1:84018036-84018058 ATGAATGAACAATGGAAGCATGG + Intergenic
910176529 1:84436693-84436715 ATGAATAGAGGAAGGAAGGAAGG + Intergenic
910280880 1:85500207-85500229 AGGAAAAAAGAAAGGAAGGAAGG - Intronic
910535693 1:88295114-88295136 CTGAAGGAAAGAAGGAAGGAAGG - Intergenic
910632347 1:89368964-89368986 TTGAATACACAAGGGAAGGTAGG - Intronic
910740445 1:90509929-90509951 CTGAACAATTAAAGGAAAGATGG + Intergenic
911047346 1:93639421-93639443 CTGAAAAAACCAAGGGAAGATGG + Intronic
911604496 1:99887615-99887637 ATAAATAAATGAAGGAAGGAAGG + Intronic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912114580 1:106389513-106389535 CGAAATAAAGGAAGGAAGGAAGG - Intergenic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912590751 1:110817398-110817420 AGGAATAAAGGAAGGAAGGAAGG - Intergenic
913029199 1:114881531-114881553 CTCCATCAAGAAAGGAAGGAAGG - Intronic
913184451 1:116356256-116356278 CGAAAGAAAGAAAGGAAGGAAGG + Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913334186 1:117693563-117693585 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
913334191 1:117693595-117693617 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
913366291 1:118042884-118042906 ATGCATAAACAAAGCAAGGAAGG - Intronic
913423738 1:118703564-118703586 CAGCACAAACAAAGGAAGGATGG + Intergenic
914796037 1:150921213-150921235 CTCAAAAAAAAAAGAAAGGAAGG + Intergenic
914925656 1:151884101-151884123 ATAAATAAATAAAGGAAGGAAGG + Intronic
914956352 1:152166207-152166229 ATGCACAAACAAAGCAAGGAAGG + Intergenic
915005028 1:152627912-152627934 AGGAAAGAACAAAGGAAGGAAGG - Intergenic
915208038 1:154285709-154285731 ATGCACAAACAAAGCAAGGAAGG + Intergenic
915324530 1:155074078-155074100 CTTAAAAAAGAAAGGAAGGAAGG - Intergenic
915582847 1:156825589-156825611 CTGAATATACAAGGTAATGATGG - Intronic
915690390 1:157683248-157683270 CAAAACAAACAAAGGAAGGTTGG + Intronic
915697661 1:157760764-157760786 ATGAAAAAAGAAAGGAAGGAAGG + Intronic
915949569 1:160179654-160179676 CTGAATGAACAAATGAGTGAGGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916149756 1:161775500-161775522 CGGAACAAAGGAAGGAAGGAAGG - Intronic
916203532 1:162294222-162294244 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
916259708 1:162829372-162829394 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
916263561 1:162867939-162867961 CTGATTACAAAAAGGAATGAAGG + Intronic
916328464 1:163590072-163590094 CGGAATGAAGGAAGGAAGGAAGG - Intergenic
916391019 1:164330993-164331015 CTGATGAAAGCAAGGAAGGAGGG - Intergenic
916486834 1:165266992-165267014 CTCAATAAATAAAGGAAAGAAGG - Intronic
916573666 1:166048766-166048788 CTTATTCAAGAAAGGAAGGAAGG - Intergenic
916779266 1:168007452-168007474 GTTAATAAATAAATGAAGGATGG - Intronic
916969162 1:169991345-169991367 CAAAAAAAAAAAAGGAAGGAAGG + Intronic
917125205 1:171681180-171681202 TTAAAGAAAGAAAGGAAGGAAGG - Intergenic
917236461 1:172897840-172897862 CTGAATAGAGAAAGACAGGAAGG - Intergenic
917483393 1:175432608-175432630 CTGAAAGAAGAAAGGAAAGATGG - Intronic
917715287 1:177729902-177729924 TCCAATAAAGAAAGGAAGGAAGG + Intergenic
917844925 1:179012744-179012766 AAGAAGAAACAAAGGAAGAAAGG + Intergenic
917951263 1:180039245-180039267 CTCAAAAAAAAAAGGAAGAAAGG + Intronic
918237473 1:182594261-182594283 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
918300710 1:183201171-183201193 ATGAATAGTCAAAGGAATGATGG + Intronic
918302845 1:183219633-183219655 CTTAAAAAAACAAGGAAGGATGG - Intronic
918544320 1:185665131-185665153 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918787989 1:188789277-188789299 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
918802018 1:188984820-188984842 CTGAAAGAAGAAAGGAAAGAAGG - Intergenic
918916653 1:190649570-190649592 ATGAAGAAAGGAAGGAAGGAAGG - Intergenic
918916654 1:190649574-190649596 AGGAATGAAGAAAGGAAGGAAGG - Intergenic
918916670 1:190649654-190649676 ATGAAGAAAGGAAGGAAGGAAGG - Intergenic
918916671 1:190649658-190649680 AGGAATGAAGAAAGGAAGGAAGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919380972 1:196860644-196860666 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
919473477 1:198007533-198007555 CTGAATGAAACAAGGAAGTAAGG - Intergenic
919487245 1:198159288-198159310 CTGGAGAAAGAAAGAAAGGAAGG + Intronic
919540090 1:198835215-198835237 ATGAATCAAGGAAGGAAGGAAGG + Intergenic
919613373 1:199774818-199774840 CTCAAAAAAGGAAGGAAGGAAGG + Intergenic
919711457 1:200733457-200733479 CTAAATAAAAAACGGAAGGAGGG - Intergenic
920162826 1:204012591-204012613 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
920165721 1:204034429-204034451 CTCAATAAAAAAAAGAAGGAAGG - Intergenic
920421462 1:205837226-205837248 ATGAATAAATGAAGGAAGAAAGG + Intronic
920574336 1:207046951-207046973 CTGAAGTAGCAAAGAAAGGAAGG + Exonic
920919227 1:210284483-210284505 AGGAATAAAGGAAGGAAGGAAGG + Intergenic
921012577 1:211157458-211157480 CTGAAAAAACAAAAGAACTAGGG + Intergenic
921200487 1:212800659-212800681 ATGAATGAAAGAAGGAAGGAGGG - Intronic
921200493 1:212800694-212800716 CTGAAAGAAGAAAGGAAGAAGGG - Intronic
921367568 1:214388148-214388170 GTGAACCAACAAAGGAAAGACGG + Intronic
921418816 1:214922332-214922354 GTGAATAAAAAAAGGAGGAAGGG - Intergenic
921670767 1:217921515-217921537 ATGAATAAACTGAGGATGGAAGG + Intergenic
921701083 1:218269854-218269876 TTCAAAAAAGAAAGGAAGGAAGG + Intergenic
921702755 1:218285978-218286000 CTTGATAATAAAAGGAAGGAAGG + Intronic
921760070 1:218902975-218902997 GTGAATAAATAAAGGACAGAAGG - Intergenic
921839388 1:219812214-219812236 CTGTATAAACGAATAAAGGAAGG + Intronic
922092307 1:222408319-222408341 CTCAATAAACAAAGTATTGATGG + Intergenic
922304329 1:224330683-224330705 GTGAAAAAGAAAAGGAAGGACGG + Intergenic
922915849 1:229257025-229257047 CTTATTACACAAAGAAAGGAAGG - Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923466474 1:234251588-234251610 ATAAATTAACATAGGAAGGATGG - Intronic
923489832 1:234474921-234474943 CTGAATTCTAAAAGGAAGGAAGG + Intronic
923509769 1:234640431-234640453 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
923675104 1:236073952-236073974 AGGAAAAAAGAAAGGAAGGAAGG - Intergenic
923828690 1:237529111-237529133 ATGAATAAATAAAGGAATGGAGG + Intronic
923988144 1:239404307-239404329 GAGAAGAAAGAAAGGAAGGAAGG + Intronic
924220491 1:241869814-241869836 CTCAAAAAAGGAAGGAAGGAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924532358 1:244904174-244904196 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
924733690 1:246735474-246735496 GTGAATAAATAAAGGCATGATGG - Intronic
924761388 1:246990103-246990125 ATGAATGAAGGAAGGAAGGAAGG + Intronic
924821539 1:247495701-247495723 AAGAAGAAAAAAAGGAAGGAAGG - Intergenic
924930587 1:248728767-248728789 ATGCATAAACAAAGCAAGGAAGG + Intronic
1063005382 10:1965204-1965226 CTGCAAAAACACAGGATGGAAGG + Intergenic
1063098650 10:2930678-2930700 CTAAAGAAATAAAGGAAGGAAGG + Intergenic
1063100874 10:2949300-2949322 TTAAAGAAAGAAAGGAAGGAAGG + Intergenic
1063111351 10:3040580-3040602 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1063188390 10:3670506-3670528 GTAAATAAAGAAAGGAAGTAAGG + Intergenic
1063257613 10:4345671-4345693 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1063506961 10:6608304-6608326 ATGAATAAAAGAAGGTAGGAAGG - Intergenic
1063587146 10:7362962-7362984 GTGAAGGAAGAAAGGAAGGAGGG - Intronic
1063721541 10:8587122-8587144 ACGAATAAAGAGAGGAAGGAAGG - Intergenic
1063772103 10:9215397-9215419 ATCAAAAAAGAAAGGAAGGAAGG - Intergenic
1063900279 10:10725811-10725833 ATAAATAAATAAGGGAAGGAAGG - Intergenic
1063915919 10:10882264-10882286 CTCAATGAAGAAAGGAAGTAAGG + Intergenic
1063953956 10:11248448-11248470 CTGAAGAATGGAAGGAAGGATGG - Intronic
1064235856 10:13574440-13574462 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1064367156 10:14718332-14718354 CTCAAGAAAGGAAGGAAGGAAGG + Intronic
1064541760 10:16412798-16412820 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1064543620 10:16429647-16429669 ATGAACAAAGAGAGGAAGGATGG + Intergenic
1064720644 10:18225588-18225610 CGGAAGAAAGGAAGGAAGGAAGG - Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1064896318 10:20241478-20241500 CTGCATACACAAAAGAAGTAAGG + Intronic
1064929195 10:20604818-20604840 CAGAAAAAAGAAAGAAAGGAAGG + Intergenic
1065055625 10:21839001-21839023 CTGGGTAAATAAAGAAAGGAAGG + Intronic
1065488337 10:26255692-26255714 AGGAATGAAGAAAGGAAGGAAGG + Intronic
1065488338 10:26255696-26255718 ATGAAGAAAGGAAGGAAGGAAGG + Intronic
1065639869 10:27770704-27770726 GGGAAGGAACAAAGGAAGGAAGG - Intergenic
1065850237 10:29781710-29781732 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1065963638 10:30753838-30753860 GTGAATAAGAAAAGGAAGGCAGG - Intergenic
1065996791 10:31066884-31066906 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1066126942 10:32350969-32350991 CTGAATAAATAAAGGATGAATGG - Intronic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1066299505 10:34084474-34084496 TTCAATAAACAATGGATGGATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067453139 10:46394711-46394733 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1067571376 10:47373824-47373846 CTGAATAAACGCAGGCAGCATGG + Intronic
1068232766 10:54192078-54192100 AGAAAGAAACAAAGGAAGGAAGG + Intronic
1068302978 10:55169974-55169996 CTGATAGAATAAAGGAAGGAAGG + Intronic
1068302979 10:55169978-55170000 TAGAATAAAGGAAGGAAGGAAGG + Intronic
1068329476 10:55543873-55543895 TTGAAGAAAAAAAGGAAGGAAGG - Intronic
1068379005 10:56223860-56223882 ATGAATAAAAAAAGGAAAGGAGG + Intergenic
1068644841 10:59454627-59454649 CTGTACAAACAAAGGAAAGCAGG - Intergenic
1068819053 10:61352188-61352210 GTGAAACAACAAAGGAAGAAAGG + Intergenic
1069035493 10:63642238-63642260 CAAAAAAAAAAAAGGAAGGAAGG - Intergenic
1069040504 10:63691124-63691146 CGAAAGAAAGAAAGGAAGGAAGG - Intergenic
1069233733 10:66044285-66044307 CTGGATAAAAAATGGAAGGCCGG - Intronic
1069244954 10:66192671-66192693 TTGAATAAATAAAGGCAGGCTGG - Intronic
1069470306 10:68682608-68682630 CTGAATTTACAAGGGAAGGCAGG - Intronic
1069649982 10:70039607-70039629 ATAAATAAAGGAAGGAAGGAAGG - Intergenic
1069649983 10:70039611-70039633 AGAAATAAATAAAGGAAGGAAGG - Intergenic
1070035613 10:72720293-72720315 CTGAAGAAATAAAGACAGGAAGG + Intronic
1070105927 10:73431299-73431321 ATTAAAAAAGAAAGGAAGGAAGG + Intronic
1070300362 10:75199248-75199270 CTCAAAAAAAAAAGAAAGGAGGG + Intergenic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1070565754 10:77602808-77602830 CTGAGTAACCAAAGCAAGCATGG + Intronic
1070678485 10:78432591-78432613 CTGAATAAATAAATAAATGAAGG - Intergenic
1071358842 10:84824811-84824833 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1071372564 10:84967255-84967277 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1071483783 10:86084307-86084329 CAAAAGAAAGAAAGGAAGGAAGG + Intronic
1071487201 10:86110268-86110290 GTGAATAAAGAATGGAAGGCCGG - Intronic
1071536196 10:86433212-86433234 TTGATTAATCAAAGGAAGGCAGG - Intergenic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1072271360 10:93780233-93780255 AGGAATAAAAGAAGGAAGGAAGG - Intronic
1072365496 10:94704564-94704586 ATGAAGGAAGAAAGGAAGGAAGG + Intronic
1072387826 10:94950158-94950180 CTCAATAAACTAAGTAATGATGG + Intronic
1072642683 10:97224212-97224234 CTAAACAAATAAAGGAAAGAAGG + Exonic
1072709124 10:97704236-97704258 CTCTAAAAAGAAAGGAAGGAAGG + Intergenic
1072761935 10:98063802-98063824 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1072828703 10:98635156-98635178 GTCAATAAATGAAGGAAGGAAGG + Intronic
1072889077 10:99305534-99305556 AGGAAAAAACAAAGGAAGGAAGG + Intergenic
1072911761 10:99508295-99508317 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1072926961 10:99624167-99624189 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1072938913 10:99741564-99741586 CAAAAGAAAAAAAGGAAGGAAGG - Intronic
1073018292 10:100419584-100419606 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1073041008 10:100605484-100605506 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1073051877 10:100672397-100672419 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1073654041 10:105393162-105393184 CTGAAGTAAGAAAGAAAGGAAGG + Intergenic
1073906246 10:108283846-108283868 ATGAATAAATAAAGGAAATATGG - Intergenic
1073995099 10:109306665-109306687 CTGAATCTGCAAAGAAAGGAAGG + Intergenic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074326481 10:112455618-112455640 GGGAAGGAACAAAGGAAGGAGGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074365910 10:112857350-112857372 ATGAACAAATGAAGGAAGGAAGG - Intergenic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1074533822 10:114314503-114314525 ATGTATTAACAAAGAAAGGAAGG + Intronic
1074813777 10:117129854-117129876 CAGGAAAAAAAAAGGAAGGAGGG + Intronic
1074839027 10:117329939-117329961 CTGTCTCAAGAAAGGAAGGAGGG + Intronic
1074845288 10:117392269-117392291 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1074903435 10:117839403-117839425 CCAAAGAAACAAAGTAAGGAGGG + Intergenic
1075013122 10:118891780-118891802 GTGAGAAAAGAAAGGAAGGAAGG + Intergenic
1075105566 10:119538103-119538125 CTGACTACAGAAAAGAAGGAAGG + Intronic
1075153230 10:119953683-119953705 AGGAAGAAAGAAAGGAAGGAGGG - Intergenic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075584453 10:123647129-123647151 GGAAAGAAACAAAGGAAGGAAGG + Intergenic
1075998376 10:126896001-126896023 ATGTCTAAAGAAAGGAAGGAAGG - Intergenic
1076666849 10:132098002-132098024 AAGAAAAAAAAAAGGAAGGAGGG - Intergenic
1077003652 11:338933-338955 CAGAATATACAAACAAAGGAAGG - Intergenic
1077480935 11:2814256-2814278 CTGAATAAAGGATGGATGGATGG + Intronic
1077733844 11:4766716-4766738 ATGAAAAAAGGAAGGAAGGAAGG - Intronic
1077821163 11:5742158-5742180 CAGAAAAAAGGAAGGAAGGAAGG + Intronic
1077827262 11:5824713-5824735 ATGCACAAACAAAGCAAGGAAGG - Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078272426 11:9808599-9808621 CTGACAAAACCCAGGAAGGATGG + Intronic
1078421157 11:11214120-11214142 AGGAATAAAGGAAGGAAGGAAGG + Intergenic
1078559682 11:12360099-12360121 TTAAAAAAAAAAAGGAAGGAAGG - Intergenic
1079131741 11:17750696-17750718 CGGAATAAGCAAAGGCAGAAGGG - Intronic
1079154523 11:17932554-17932576 CTGAATAAAAAAAGAAAGATGGG + Intronic
1079351139 11:19693091-19693113 CTGAAAATACAAGGGCAGGAGGG - Intronic
1079489169 11:20968346-20968368 TTAAAGAAAGAAAGGAAGGAAGG + Intronic
1079806669 11:24939534-24939556 CTAAATATTCATAGGAAGGAAGG + Intronic
1080047326 11:27822437-27822459 GGGAATAAAAAGAGGAAGGAAGG - Intergenic
1080093908 11:28382051-28382073 CCAAATAAACAAAAGAAAGAAGG - Intergenic
1080421876 11:32117882-32117904 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1080597337 11:33785207-33785229 CTGAAAGAAGGAAGGAAGGAAGG + Intergenic
1080604681 11:33855180-33855202 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1080997506 11:37621797-37621819 TTGAATAAAACAAAGAAGGAAGG - Intergenic
1081346148 11:41988851-41988873 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1081405984 11:42698305-42698327 ATGAAAAAAGAAATGAAGGAAGG + Intergenic
1081576733 11:44323346-44323368 ATGAATGAAGAAAGGAAGGAAGG + Intergenic
1081692884 11:45089938-45089960 CTTAATAGAAGAAGGAAGGAAGG + Intergenic
1081968133 11:47181850-47181872 AATAATAAACAAAGGAAAGAAGG + Intronic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1083032188 11:59603278-59603300 CTTAATAAATAAATAAAGGAAGG + Intronic
1083283658 11:61643697-61643719 CTGATTAAACAAAGTATGGAAGG + Intergenic
1083338626 11:61944266-61944288 CTGTCTCAACAAAGGAGGGAAGG - Intergenic
1083353708 11:62049314-62049336 ATGAATGAAGCAAGGAAGGAAGG + Intergenic
1083411557 11:62496821-62496843 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1083549003 11:63571748-63571770 CTCAAAAAAAAAAGGAAGAAAGG + Intergenic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084703871 11:70804665-70804687 ATGATTCAACAAAGGAAAGAAGG - Intronic
1085013912 11:73159948-73159970 CTGAATTAACAAAGGCAGCTGGG - Intergenic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085173677 11:74468675-74468697 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1085173685 11:74468715-74468737 CTGTCTAAAGGAAGGAAGGAAGG - Intergenic
1085186309 11:74578800-74578822 ATGAATGAAGGAAGGAAGGAAGG + Intronic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1085308756 11:75503610-75503632 CTGAATAAATGAGCGAAGGAAGG + Intronic
1085408734 11:76279190-76279212 TTGAATCAACAAAAGAAGGTGGG - Intergenic
1085510261 11:77084555-77084577 CTGGTCAAACAAAGGAAGGCAGG + Intronic
1085609794 11:77936754-77936776 CTGGAGAAAGAAAGGAAGGAAGG + Intronic
1085651286 11:78271016-78271038 CTGAATAAATGGAGGAGGGATGG + Intronic
1085696066 11:78705699-78705721 ATGAATGAACGAAGGAAGGAAGG + Intronic
1086480263 11:87228250-87228272 TGGAATAAATAAATGAAGGAGGG + Intronic
1086907644 11:92435542-92435564 AAGAATAAAGAAAGGAAGGAAGG - Intronic
1087039951 11:93788904-93788926 CTTAAAAAAAAAGGGAAGGAAGG - Intronic
1087058623 11:93957195-93957217 CTGAATGAACTAAGAAAGGAAGG + Intergenic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1087522398 11:99257250-99257272 GTGAATAAAACCAGGAAGGAAGG + Intronic
1087543898 11:99559305-99559327 CTGAATAAATAAAGGAAATATGG - Intronic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088333713 11:108679838-108679860 CTTAATAAACGAAGGGAGAAGGG + Intronic
1088572409 11:111235266-111235288 CCAAAAAAAAAAAGGAAGGAAGG + Intergenic
1088599002 11:111459451-111459473 CTGAATTCAGAAAGGAAGAAAGG - Intergenic
1088758719 11:112909203-112909225 ATCAAGGAACAAAGGAAGGAAGG - Intergenic
1088772253 11:113046855-113046877 CAGAAGAAAGAAAGGAAGGAAGG + Intronic
1088989945 11:114944546-114944568 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089357959 11:117867771-117867793 TGGAATAAACAAAGAAGGGAAGG - Intronic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089748969 11:120636837-120636859 CTCAAAAAAAAAAGAAAGGAAGG + Intronic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1089923276 11:122230676-122230698 ATGAATATAGGAAGGAAGGAAGG - Intergenic
1089923277 11:122230680-122230702 TTGAATGAATATAGGAAGGAAGG - Intergenic
1090023763 11:123150393-123150415 ATGAACAAAAGAAGGAAGGAAGG + Intronic
1090044193 11:123316792-123316814 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
1090236691 11:125153467-125153489 TTGATTATACAAAGTAAGGAAGG - Intergenic
1090461997 11:126899431-126899453 CTGACAAAGGAAAGGAAGGAGGG + Intronic
1090531103 11:127592107-127592129 AGGAATAAAGAAAGGAGGGAAGG + Intergenic
1090531134 11:127592216-127592238 AGGAATAAAGAAAGGAGGGAAGG + Intergenic
1090531167 11:127592337-127592359 ACGAAGGAACAAAGGAAGGAAGG + Intergenic
1090552197 11:127833510-127833532 CTCAATAAACAAGGAAAAGAGGG + Intergenic
1090718743 11:129453638-129453660 GTGAATAGACAAAGGAGGGGAGG + Intergenic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1091060027 11:132452509-132452531 CTGAAAGAAGGAAGGAAGGAAGG - Intronic
1091131243 11:133148851-133148873 CTGAAAAAGGGAAGGAAGGAAGG + Intronic
1091755766 12:3050453-3050475 CTAAAAAAAGGAAGGAAGGAAGG - Intergenic
1091913610 12:4251577-4251599 TTGAAAGAACAAAGGAAGGAAGG + Intergenic
1092154384 12:6273055-6273077 CTCAAAAAAAAAAGGAAGGCGGG - Intergenic
1092359799 12:7826845-7826867 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
1092486582 12:8907506-8907528 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1092490822 12:8943353-8943375 CTTAAAAACAAAAGGAAGGAAGG + Intronic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092611982 12:10182131-10182153 ATGACTATACAAAGGAAGAAGGG - Intronic
1092623511 12:10300515-10300537 GTGAATAAACAAAGTCTGGATGG - Intergenic
1093071766 12:14713232-14713254 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1093102650 12:15046421-15046443 TAGAATAAAGAAAGGAAGAAGGG - Intergenic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093685771 12:22052365-22052387 ATGAATGAACGAAAGAAGGAAGG + Intronic
1093743723 12:22716087-22716109 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
1094022100 12:25925585-25925607 CAGAAAAAAGGAAGGAAGGAAGG + Intergenic
1094083643 12:26565428-26565450 ATGAATGAAAATAGGAAGGAAGG + Intronic
1094117215 12:26929746-26929768 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1094135939 12:27126221-27126243 ATTAATAAAAAAAGGAAAGAAGG - Intergenic
1094185484 12:27637968-27637990 ATTAATAAAAAAAGGAAAGAAGG - Intronic
1094331744 12:29301676-29301698 CTGAATTAAGAAGGGAAGGGAGG + Intronic
1094479428 12:30870003-30870025 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1094583850 12:31758874-31758896 ATTAATAAACAAAGCAAGGCCGG + Intergenic
1094599857 12:31898857-31898879 AGGAAAGAACAAAGGAAGGAAGG + Intergenic
1094738744 12:33264429-33264451 AGGAATAAAGAAAAGAAGGAAGG - Intergenic
1094769920 12:33644040-33644062 CTTAATATACAATGGAAGGTGGG + Intergenic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1095857237 12:46873845-46873867 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1095857260 12:46873964-46873986 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1095857407 12:46875181-46875203 AAATATAAACAAAGGAAGGAAGG + Intergenic
1095880819 12:47134350-47134372 TTGAAGGAAGAAAGGAAGGAAGG - Intronic
1095894353 12:47265552-47265574 CTGAATGAAGGAAGGAAGGGAGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096140882 12:49241653-49241675 CTCAAAAAAGGAAGGAAGGAAGG - Intronic
1096638048 12:52973814-52973836 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1096757490 12:53812305-53812327 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1097028252 12:56074490-56074512 CTGAATAAATGAAAGAAGGGAGG - Intergenic
1097131350 12:56812992-56813014 ATGAAGGGACAAAGGAAGGAAGG - Intergenic
1097356290 12:58605862-58605884 GAGAAGAAAAAAAGGAAGGAAGG - Intronic
1097426607 12:59453547-59453569 TTAAAAAAACAAAAGAAGGAGGG + Intergenic
1097488120 12:60231800-60231822 CAGTATAGAGAAAGGAAGGAAGG - Intergenic
1097543312 12:60967793-60967815 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1097719874 12:63008906-63008928 CTGCTGAAACAAAGAAAGGACGG - Intergenic
1097802639 12:63931844-63931866 GAGAATAGACAAAGGAATGAGGG + Intronic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1097910355 12:64962899-64962921 CTCAATAAACAAAGTATTGAAGG - Intergenic
1098233298 12:68394852-68394874 CTCAAGAAAGAAAGGAAAGAAGG - Intergenic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1099226720 12:79978961-79978983 ATGAAGGAACGAAGGAAGGAAGG - Intergenic
1099609386 12:84848305-84848327 AGGAAGAAAGAAAGGAAGGAGGG + Intergenic
1100062530 12:90599205-90599227 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100916749 12:99432446-99432468 CTTTATAAAACAAGGAAGGAAGG + Intronic
1100941658 12:99729546-99729568 ATGATTAAATAAAGGAAGGTAGG - Intronic
1100983482 12:100183049-100183071 CAAAAGAAACAAAGGAAGGAAGG + Intergenic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101255573 12:102973694-102973716 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1101389325 12:104286175-104286197 CTGAATGAAGGAAGGAAGGAAGG - Intronic
1101566079 12:105906830-105906852 ATGAATGAAGAAAGGAAGGTGGG + Intergenic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1102155232 12:110720938-110720960 CTAAATCAAAAATGGAAGGAAGG + Intronic
1102306661 12:111810005-111810027 CTCAATAACCAAAGGAAGGTGGG + Intergenic
1102499261 12:113340177-113340199 CTTAAAAAAAAAAGGAGGGAAGG + Intronic
1102513308 12:113429993-113430015 AAGAATGAAGAAAGGAAGGAGGG - Intronic
1102539593 12:113609189-113609211 ATGAATGAAGGAAGGAAGGAAGG - Intergenic
1102539594 12:113609193-113609215 ATGAATGAATGAAGGAAGGAAGG - Intergenic
1102552492 12:113702017-113702039 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1102683817 12:114708762-114708784 ATGAAGAAAGAAAGGAAGAAAGG - Intergenic
1103154406 12:118671813-118671835 CTGGGTAAATAAAGAAAGGAAGG - Intergenic
1103468346 12:121160145-121160167 CTAAAAAAAGAAAGAAAGGAAGG - Intronic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103546993 12:121709240-121709262 CTGAAAGAAAGAAGGAAGGAAGG - Intergenic
1103652432 12:122443394-122443416 GGGAATGAAGAAAGGAAGGAAGG - Intergenic
1104177238 12:126344714-126344736 ATGAATAAATAAAGGAAGAAAGG + Intergenic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1104384755 12:128340864-128340886 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104569497 12:129912572-129912594 CGGAACAAAGGAAGGAAGGAAGG + Intergenic
1104950945 12:132439683-132439705 GAGAAAAAAAAAAGGAAGGAAGG - Intergenic
1105238295 13:18582964-18582986 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1105362653 13:19735001-19735023 CAAAAAAAACAAAGAAAGGAAGG + Intronic
1105966335 13:25388157-25388179 CAGAATTAAGAAAGGAAGGGAGG + Intronic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106266911 13:28118776-28118798 CAAAAAAAAGAAAGGAAGGAAGG - Intergenic
1106467270 13:30024146-30024168 CTGTCCAAAGAAAGGAAGGAAGG + Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1107750638 13:43561962-43561984 CTGTCAAAAAAAAGGAAGGAAGG + Intronic
1108111251 13:47075548-47075570 CTGAATAAAGAAAGAAATTAAGG + Intergenic
1108146327 13:47481080-47481102 CTTAAAAGACAAAGGAAGCAGGG + Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108826756 13:54421842-54421864 CTCAATAAACAAAATCAGGAAGG + Intergenic
1108860284 13:54849672-54849694 CTAAATCAACATAGAAAGGAAGG - Intergenic
1108903644 13:55444178-55444200 AGGAACAAACAGAGGAAGGAGGG - Intergenic
1108913884 13:55585237-55585259 CTGAGTTGAGAAAGGAAGGAGGG + Intergenic
1109184834 13:59255658-59255680 TTGAATGAAAAAAAGAAGGAAGG + Intergenic
1109227960 13:59719720-59719742 CTGAATAAAGAAATGACAGATGG + Intronic
1109371911 13:61433137-61433159 ATGAAGAAAAAAATGAAGGAAGG - Intergenic
1109373636 13:61458651-61458673 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1109382682 13:61585041-61585063 ATGAATGAACGAATGAAGGAAGG + Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1109518089 13:63470199-63470221 GAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109648442 13:65291997-65292019 AAGAAAAAAAAAAGGAAGGAAGG + Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109847618 13:68016414-68016436 CTGAAGAATAAAAGGAGGGATGG - Intergenic
1110023514 13:70506834-70506856 AAGAAGAAATAAAGGAAGGATGG + Intergenic
1110158229 13:72343758-72343780 CTGAAGGAACAAAGCAAGCAGGG - Intergenic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1111048303 13:82846367-82846389 AGGAAGAAACAAAGGTAGGAAGG + Intergenic
1111048493 13:82847005-82847027 AGGAAGAAACAAAGGAAGGAAGG + Intergenic
1111319193 13:86603098-86603120 ATAAAAAAATAAAGGAAGGAAGG - Intergenic
1111588121 13:90308831-90308853 TTTAATAAAGAAAGGAAGAATGG + Intergenic
1111856216 13:93640819-93640841 AGGAAGGAACAAAGGAAGGAAGG - Intronic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112079566 13:95954391-95954413 CTGAATTCCAAAAGGAAGGAGGG - Intronic
1112200291 13:97268092-97268114 CAAAAGAAAGAAAGGAAGGAAGG - Intronic
1112426869 13:99310330-99310352 CTCAAGAAAAAAAGAAAGGATGG + Intronic
1112706248 13:102072374-102072396 ATAAATAAATAAAGGATGGAGGG + Intronic
1113001606 13:105644895-105644917 CTGAAAGAAAAAAGGAAGGAAGG - Intergenic
1113130448 13:107030941-107030963 TTGAATAAATGAAGGAAGGAAGG - Intergenic
1113742725 13:112722541-112722563 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1114036994 14:18638610-18638632 CTGAATTAAGAAGGGAAGGGAGG + Intergenic
1114071756 14:19115689-19115711 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1114090503 14:19284275-19284297 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1114121645 14:19676434-19676456 CTGAATTAAGAAGGGAAGGGAGG - Intergenic
1114281787 14:21198902-21198924 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1114333023 14:21657377-21657399 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1114787259 14:25615285-25615307 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1114914537 14:27246506-27246528 CTGAATAATCAATGGATGGATGG - Intergenic
1115078647 14:29422809-29422831 CTGAATAAAAAAAGAAAGGAAGG - Intergenic
1115156571 14:30346648-30346670 CTGAAAAAATAAAGGAAGGGAGG + Intergenic
1115181043 14:30626103-30626125 CTGAAATAACACAGGAAGCACGG - Intronic
1115543123 14:34441485-34441507 ATGCATAAACAAAGCAAGGAAGG - Intronic
1115762096 14:36584760-36584782 TTAAAAAAAAAAAGGAAGGAAGG - Intergenic
1115824266 14:37248959-37248981 CTGAAAAACAAATGGAAGGATGG + Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1115858925 14:37662324-37662346 CTCAATAAACAAAGTATTGAAGG - Intronic
1116079061 14:40150318-40150340 ATGAATGAATGAAGGAAGGAAGG - Intergenic
1116305453 14:43248102-43248124 TGGAAGAAAGAAAGGAAGGATGG - Intergenic
1116446191 14:45014970-45014992 TTGAATAAAAACAGGAAGGTAGG - Intronic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1116738362 14:48723658-48723680 ATGAAGAAACAAGGGAAGGGTGG + Intergenic
1117010834 14:51468803-51468825 CATAATAAAGAAAGGAAGGAAGG - Intergenic
1117162818 14:53005949-53005971 CTGAGTAAATAAATGAAGGCTGG - Intergenic
1117246819 14:53894987-53895009 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1117625576 14:57634334-57634356 ATGAAAGAATAAAGGAAGGAAGG - Intronic
1117845559 14:59907849-59907871 GTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1117971367 14:61254018-61254040 TTGAAAGAAGAAAGGAAGGAAGG - Intronic
1118179042 14:63472653-63472675 AGGAATAAACAAAGGAAAGGTGG + Intronic
1118294794 14:64559092-64559114 ATAAATAAACAGAGAAAGGAAGG + Intronic
1118388146 14:65273880-65273902 GTCAAGAAAGAAAGGAAGGAGGG + Intergenic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1118430382 14:65713281-65713303 ATGAATAAACAAAGAAAATATGG - Intronic
1118465761 14:66029677-66029699 CTGGATAAATAAAGAAATGAAGG - Intergenic
1118875700 14:69783200-69783222 GAGAATAAATAAAGGAATGAAGG - Intronic
1119034486 14:71218157-71218179 CAAAAGAAAGAAAGGAAGGAAGG - Intergenic
1119230573 14:72976202-72976224 ATGAATGAAGGAAGGAAGGAAGG + Intronic
1119235375 14:73015227-73015249 CTGAAGGAAGGAAGGAAGGAAGG + Intronic
1119377482 14:74206412-74206434 CTCACCAAAAAAAGGAAGGAAGG - Intergenic
1119422780 14:74517347-74517369 ATAAATAAATAAAGGAAGAAAGG - Intronic
1119513627 14:75230845-75230867 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1119577614 14:75741353-75741375 CTGAATGCACTAAGGAAGTAAGG - Intronic
1120039088 14:79731785-79731807 CTAATTTAAAAAAGGAAGGAAGG - Intronic
1120096179 14:80390437-80390459 AGGAAGAAACGAAGGAAGGAAGG - Intergenic
1120427241 14:84364027-84364049 TTGATTAAAAAAAGAAAGGAAGG + Intergenic
1120801085 14:88689554-88689576 TTGAATGAAGGAAGGAAGGAAGG - Intronic
1121077093 14:91077853-91077875 ATGAAGGAAGAAAGGAAGGAAGG + Intronic
1121166817 14:91809904-91809926 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
1121326559 14:93023572-93023594 TTGTTGAAACAAAGGAAGGATGG + Intronic
1121377108 14:93422469-93422491 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1121441945 14:93955073-93955095 GTGAATGAATGAAGGAAGGAAGG - Intronic
1121584122 14:95051253-95051275 CTGAATAGACAAGGCAGGGAGGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121716468 14:96079610-96079632 ATGAATAATGAAAGGATGGATGG + Intronic
1121859802 14:97306605-97306627 CTGAATAACGAAAGAAAGAATGG - Intergenic
1121953613 14:98194513-98194535 CTTAAAACACAAAGGAAAGATGG + Intergenic
1121956618 14:98219290-98219312 TTGAATAAATGAAGGAATGATGG + Intergenic
1121961895 14:98267819-98267841 CTGAACAAGCAAAGGAAGAAGGG - Intergenic
1122164339 14:99810294-99810316 TTGAACAAAGAAATGAAGGAAGG - Intronic
1122181642 14:99959306-99959328 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1123976829 15:25561577-25561599 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
1124074216 15:26427561-26427583 ACCAAAAAACAAAGGAAGGAGGG - Intergenic
1124471088 15:29986763-29986785 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1124501627 15:30232551-30232573 CTGAAAGAAGGAAGGAAGGAAGG - Intergenic
1124623190 15:31291335-31291357 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1124741938 15:32306100-32306122 CTGAAAGAAGGAAGGAAGGAAGG + Intergenic
1124832378 15:33161620-33161642 TTAAAAAAACAAAGGAAGGCTGG + Intronic
1125066353 15:35490198-35490220 CTAAAGGAAGAAAGGAAGGAAGG + Intronic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1125216296 15:37279356-37279378 CTCAATAAACTAAGGATTGATGG - Intergenic
1125638031 15:41205689-41205711 CTCAAAAAAGTAAGGAAGGAGGG + Intronic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1126135352 15:45384707-45384729 CTCAAAAAACAAAGGAGGGGTGG - Intronic
1126163125 15:45632224-45632246 CTCCATCAAAAAAGGAAGGAAGG - Intronic
1126183938 15:45812125-45812147 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1126286106 15:47012911-47012933 ATGAAGAGACAAAGGAAGCAGGG - Intergenic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126419882 15:48460323-48460345 ATGATTAAACAAAGGTGGGATGG + Intronic
1126454535 15:48846986-48847008 CTGAAAAAAAAAAGAAAGAAAGG + Intronic
1126560668 15:50040335-50040357 CTGAAGAGGCAAAGGAATGAAGG - Intronic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1126878819 15:53072571-53072593 TTGAATGAAGGAAGGAAGGAAGG - Intergenic
1126878821 15:53072579-53072601 CTGAATAATTGAATGAAGGAAGG - Intergenic
1126897530 15:53275029-53275051 ATGAAAAAAGGAAGGAAGGAGGG - Intergenic
1126897532 15:53275033-53275055 AGGAATGAAAAAAGGAAGGAAGG - Intergenic
1126907473 15:53383574-53383596 GTGAATTAACTTAGGAAGGAAGG + Intergenic
1126919953 15:53510162-53510184 CTGAAAAAAAGAAGGAAGGAAGG - Intergenic
1127096694 15:55518256-55518278 AGAAAGAAACAAAGGAAGGAAGG - Intergenic
1127122825 15:55786084-55786106 AGGAATAAAGGAAGGAAGGAAGG + Intergenic
1127291794 15:57577991-57578013 GTAAATAAATGAAGGAAGGAAGG + Intergenic
1127302935 15:57675328-57675350 ATGAATGAAGGAAGGAAGGAAGG - Intronic
1127302936 15:57675332-57675354 TTGAATGAATGAAGGAAGGAAGG - Intronic
1127375065 15:58376820-58376842 CAGAAGAAAGGAAGGAAGGAAGG + Intronic
1127522970 15:59761567-59761589 AGAAAGAAACAAAGGAAGGAAGG - Intergenic
1127660817 15:61098319-61098341 AGGAATGAAGAAAGGAAGGAGGG - Intronic
1127894091 15:63279514-63279536 TTGAATAAAGGAAGAAAGGAAGG - Intronic
1128076569 15:64830174-64830196 CAGACTAAACCAAGGAAGGCAGG + Intergenic
1128490808 15:68141336-68141358 GAGAATTAAGAAAGGAAGGAAGG - Intronic
1128540914 15:68531494-68531516 CTCAAAAAAGGAAGGAAGGAAGG + Intergenic
1128701338 15:69806710-69806732 GTGAGTAAAGAATGGAAGGAGGG - Intergenic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129039614 15:72674732-72674754 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1129040718 15:72684128-72684150 ATGCACAAACAAAGCAAGGAAGG + Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129124962 15:73431526-73431548 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1129166055 15:73778372-73778394 AAGAAGAAAAAAAGGAAGGAAGG + Intergenic
1129292468 15:74578891-74578913 CTCAAAAAACAAAAGAAAGAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129695514 15:77738746-77738768 CTGAAGGAAGGAAGGAAGGAAGG + Intronic
1129770280 15:78199127-78199149 CTCAAAAAAAGAAGGAAGGAAGG - Intronic
1130068522 15:80627075-80627097 CTCAGAAAACAAAGGAAGAAAGG - Intergenic
1130379815 15:83361821-83361843 TTGAATAAACGAATGAATGAAGG + Intergenic
1130553865 15:84909350-84909372 TGGAAGAAAGAAAGGAAGGATGG - Intronic
1130636261 15:85623513-85623535 CAGAACTAACAAAGGAAGCAGGG - Intronic
1130761520 15:86825620-86825642 GAAAATAAAAAAAGGAAGGAAGG + Intronic
1131700165 15:94926860-94926882 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1131744344 15:95430003-95430025 GAAAATAAAGAAAGGAAGGAAGG - Intergenic
1131753831 15:95538977-95538999 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1133216031 16:4293079-4293101 CTCAAAAAAGAAAAGAAGGAAGG - Intergenic
1133389301 16:5396337-5396359 CTGAATAGATGAAAGAAGGAGGG + Intergenic
1133698279 16:8285837-8285859 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1133711713 16:8408080-8408102 AGGAATAAAGGAAGGAAGGAAGG - Intergenic
1133812275 16:9169955-9169977 CTCAAAAAACAAAGAAAGAAAGG - Intergenic
1133816103 16:9198629-9198651 CAAAAAAAAAAAAGGAAGGAAGG - Intergenic
1133979711 16:10624108-10624130 AAGAACAAAGAAAGGAAGGAAGG + Intergenic
1134006317 16:10820832-10820854 CTCAAGAAAGAAAGAAAGGAAGG - Intergenic
1134094877 16:11412710-11412732 CTGCATAAACAAGGGCAGGGAGG - Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134129599 16:11640256-11640278 GTGAATGAACAAACGAATGAAGG + Intergenic
1134261420 16:12654240-12654262 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1134570409 16:15285681-15285703 CGAAAGAAAGAAAGGAAGGAAGG + Intergenic
1134688886 16:16177982-16178004 GAAAAGAAACAAAGGAAGGAAGG + Intronic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135226119 16:20659686-20659708 CTGGATATGGAAAGGAAGGAAGG - Intronic
1135348271 16:21707698-21707720 GAGAAGAAAGAAAGGAAGGAAGG - Intronic
1135491443 16:22913113-22913135 GAGAAGAAAGAAAGGAAGGAAGG + Intronic
1135746369 16:25020166-25020188 AGAAATAAAGAAAGGAAGGAAGG + Intergenic
1135795090 16:25433922-25433944 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1136065177 16:27753841-27753863 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1136332245 16:29587838-29587860 CTCAAAAAAAAAAGAAAGGAAGG + Intergenic
1136606056 16:31334592-31334614 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1136694030 16:32060242-32060264 ATGATTAAACAAAGAAACGATGG - Intergenic
1136794524 16:33003505-33003527 ATGATTAAACAAAGAAACGATGG - Intergenic
1136875385 16:33850886-33850908 ATGATTAAACAAAGAAACGATGG + Intergenic
1137254824 16:46766144-46766166 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137408362 16:48207657-48207679 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1137469575 16:48742622-48742644 CTGTATAAAGAAAGGGAGGCAGG + Intergenic
1137622418 16:49884638-49884660 GAGGATAAAGAAAGGAAGGAAGG + Intergenic
1137652445 16:50132144-50132166 CTGAATCAACAAAAAAAGAAGGG - Intergenic
1137683348 16:50369290-50369312 GGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1137776663 16:51060712-51060734 GTGAGTAAAAAAGGGAAGGAAGG + Intergenic
1137871533 16:51954598-51954620 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
1138130460 16:54475158-54475180 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1138177204 16:54911125-54911147 GTGGAAAAAGAAAGGAAGGAAGG - Intergenic
1138569091 16:57856454-57856476 CTAAAAAAAGAAAGGAAGGAAGG + Intronic
1138570995 16:57873097-57873119 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1138612684 16:58139683-58139705 CTCAATTTAAAAAGGAAGGAAGG - Intergenic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1138951158 16:61915099-61915121 CTTATTTTACAAAGGAAGGAAGG - Intronic
1139074468 16:63427268-63427290 GTGAATAAATAAATGAAGGGAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139514673 16:67446139-67446161 CTGAAGAAAGAAAGGAGGGGAGG + Intronic
1139550835 16:67672163-67672185 ATAAATAAAGAAAGGAGGGAGGG + Intergenic
1140172912 16:72625964-72625986 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1140403837 16:74694404-74694426 CTCCAAAAACAAAGGATGGAGGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140498150 16:75408097-75408119 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
1140498151 16:75408101-75408123 CTCAAAAAAGGAAGGAAGGAAGG + Intronic
1140527806 16:75638031-75638053 CTGAATGTTCAAAGGAAGCACGG - Intronic
1140768562 16:78182564-78182586 CTGAACAAAAGAAGGAAGGGAGG - Intronic
1140831062 16:78751822-78751844 CTAGAAAAAGAAAGGAAGGAGGG + Intronic
1140905875 16:79408639-79408661 GTGAAAAAAGAAAAGAAGGATGG - Intergenic
1141176776 16:81725729-81725751 CAAAAAAAAAAAAGGAAGGAAGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1141536965 16:84688533-84688555 CAAAAAAAAGAAAGGAAGGAAGG - Intergenic
1141581860 16:85004713-85004735 GTGAATAAGTAAGGGAAGGAGGG + Intronic
1141734694 16:85844341-85844363 CTAAAAAAAAAAAAGAAGGAAGG - Intergenic
1141984549 16:87571320-87571342 CTGAGCAAATAAAGGAGGGAAGG - Intergenic
1142029763 16:87832690-87832712 ATAAGTAAACAAAGGAGGGAAGG + Exonic
1203096787 16_KI270728v1_random:1265156-1265178 ATGATTAAACAAAGAAACGATGG - Intergenic
1142473983 17:179369-179391 CTGAACCCACAAAGCAAGGAGGG - Intronic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1142999754 17:3785466-3785488 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1143009109 17:3856097-3856119 GTGAAAAAAAGAAGGAAGGAAGG - Intergenic
1143054498 17:4152712-4152734 ATGAATAAAGAAAGGAATCAGGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143618255 17:8066220-8066242 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1143674152 17:8418727-8418749 AGGAAAGAACAAAGGAAGGAAGG - Intronic
1143701338 17:8662605-8662627 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1143725625 17:8843298-8843320 AGGAAAAAAGAAAGGAAGGAAGG - Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1143888920 17:10087521-10087543 ATGAATGAAGAAAGGAAGGAAGG + Intronic
1143911007 17:10248998-10249020 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1143964377 17:10746235-10746257 CTGAAGAAAGGAAGGAAGGGAGG + Intergenic
1144174194 17:12688698-12688720 TGGAAGAAAAAAAGGAAGGAAGG - Intronic
1144377600 17:14660988-14661010 CTGCATAAAAAAAGATAGGAAGG + Intergenic
1144572035 17:16406396-16406418 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1144608533 17:16689127-16689149 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1144868497 17:18352871-18352893 CTGAAAGAAGAAAGAAAGGAAGG + Intronic
1145167246 17:20623937-20623959 CTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1145978733 17:28999088-28999110 CTGAATGGAGAATGGAAGGATGG + Intronic
1146134149 17:30304094-30304116 CTTAAAAAAGAAAGGAAGGCCGG + Intergenic
1146422254 17:32698381-32698403 CTTAAAAAAGAAAAGAAGGAAGG - Intronic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1146728556 17:35174880-35174902 CGGAAGGAAAAAAGGAAGGAGGG + Intronic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147247802 17:39133505-39133527 TTGAATGAACAAAGGAAGTAGGG - Intronic
1147361415 17:39933050-39933072 CTCAAAAAATAAAGAAAGGAAGG + Intergenic
1147361416 17:39933054-39933076 AAAAATAAAGAAAGGAAGGAAGG + Intergenic
1147446697 17:40479146-40479168 CTCAAAAAAGGAAGGAAGGAAGG - Intronic
1148239017 17:45987950-45987972 CTGAATGAATGAATGAAGGAAGG - Intronic
1148396059 17:47309046-47309068 CTCAAAAAAAGAAGGAAGGAGGG - Intronic
1148613612 17:48982184-48982206 CAAAAGAAAGAAAGGAAGGAAGG - Intergenic
1148661945 17:49341320-49341342 CTGAAAAAAAAAAAGATGGATGG + Intronic
1148710857 17:49679579-49679601 ATAAATAAATAAAGGAAGGAAGG + Intergenic
1148710858 17:49679583-49679605 ATAAATAAAGGAAGGAAGGAAGG + Intergenic
1148728638 17:49816100-49816122 GGGAATAAAAAAAGGAAGGGAGG - Intronic
1148764004 17:50027080-50027102 TTGAATAAATAAATGATGGATGG - Intergenic
1148803581 17:50250711-50250733 AAAAATAAAGAAAGGAAGGAAGG + Intergenic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149023178 17:51993816-51993838 ATAAAAGAACAAAGGAAGGAGGG - Intronic
1149128303 17:53262878-53262900 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149504170 17:57179558-57179580 CTGAAAGAAGAAAGGAAAGAAGG + Intergenic
1149749234 17:59129478-59129500 CAAAAGAAAGAAAGGAAGGAAGG + Intronic
1150105785 17:62461586-62461608 CTTAAGGAAGAAAGGAAGGAAGG - Intronic
1150142569 17:62742677-62742699 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
1150281002 17:63929603-63929625 CTGAATGAAGGAAGGAAGGAAGG + Intronic
1150296791 17:64014305-64014327 CTGAAAGAAGGAAGGAAGGAAGG + Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1151036387 17:70805130-70805152 CTGACAAAAGAAAGAAAGGAAGG + Intergenic
1151409537 17:73912686-73912708 CTGAAGACAGGAAGGAAGGAAGG - Intergenic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1151879689 17:76887534-76887556 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
1153168778 18:2292158-2292180 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1153234035 18:2968655-2968677 CTGAACAGATTAAGGAAGGAAGG + Intronic
1153239186 18:3015253-3015275 CTGAATGATGAAAGGAAGGAAGG - Intergenic
1153714209 18:7829833-7829855 ATAAGTAAACAAAGGAGGGAGGG - Intronic
1153739521 18:8108910-8108932 TTTAATAAACAAAGGCAGCATGG + Intronic
1153757948 18:8302338-8302360 CTGAAGAACTAAAGGAAGGCTGG + Intronic
1153881678 18:9426681-9426703 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1154050606 18:10952914-10952936 ATGAAAAAAAGAAGGAAGGAAGG - Intronic
1154113075 18:11586969-11586991 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1154165632 18:12012265-12012287 CTGAAGCCAGAAAGGAAGGATGG - Intronic
1154213472 18:12398798-12398820 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1155146226 18:23085970-23085992 CTGAATCTAGAAAGAAAGGAAGG + Intergenic
1155603276 18:27574192-27574214 CAGAAAAAACACAGCAAGGATGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155836964 18:30597919-30597941 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1155878673 18:31117531-31117553 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1156063183 18:33106297-33106319 GAAAATAAAGAAAGGAAGGAAGG + Intronic
1156127569 18:33925788-33925810 TTGAAAAAAGGAAGGAAGGAAGG + Intronic
1156186732 18:34671738-34671760 ATGAAGAAATAAAGGAAGAAAGG - Intronic
1156227939 18:35127513-35127535 CTGAAGAAAGAAAGGAAGAAGGG - Intronic
1156328339 18:36094849-36094871 AAGAACAAAGAAAGGAAGGAAGG + Intergenic
1156359869 18:36375524-36375546 CTTAATAAAAACAGGAATGAAGG - Intronic
1156408510 18:36805840-36805862 CTTGCTAAACAAAGGAAAGAGGG - Intronic
1156764341 18:40633109-40633131 CTGCATGAAGAAAGGAAAGAAGG + Intergenic
1156798958 18:41085047-41085069 GAGAATAAACTAAGGAAGAAAGG + Intergenic
1156838289 18:41581865-41581887 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1156889852 18:42178288-42178310 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
1156889861 18:42178320-42178342 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
1156908665 18:42384946-42384968 CAGAAGAAAGAAAGGAAGAAGGG - Intergenic
1156909311 18:42391943-42391965 CATAAGAAAGAAAGGAAGGAAGG - Intergenic
1157013740 18:43683329-43683351 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1157428766 18:47606051-47606073 CTGAATCTGGAAAGGAAGGAAGG + Intergenic
1157603278 18:48908737-48908759 CTGAATAATCAAAACAAGCAGGG + Intergenic
1157954726 18:52084169-52084191 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1158134864 18:54197126-54197148 ATGAATGAATAAAGGAAGAAAGG - Intronic
1158189076 18:54804975-54804997 CTAAAAAAAAAAAGGAAGGAAGG - Intronic
1158700062 18:59737576-59737598 ATCAAGAAAGAAAGGAAGGAAGG + Intergenic
1158808907 18:61008003-61008025 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1159106580 18:64008212-64008234 CTTAATAAACAAAGGAGAGAGGG + Intergenic
1159259208 18:65990256-65990278 CAAAAAAAAGAAAGGAAGGAAGG + Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1159719765 18:71873652-71873674 AAGAAAAAAAAAAGGAAGGAAGG - Intergenic
1159737333 18:72115737-72115759 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1159888101 18:73928538-73928560 CTGATTCCATAAAGGAAGGAAGG + Intergenic
1159962889 18:74569002-74569024 GGGAAAAAACAAAGGCAGGAGGG + Intronic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1160895985 19:1402090-1402112 TTCAAAAAAGAAAGGAAGGAAGG - Intergenic
1161139672 19:2639924-2639946 GTGAAGGAAGAAAGGAAGGAGGG + Intronic
1161385625 19:3990887-3990909 AGGAACAAAAAAAGGAAGGAAGG - Intergenic
1161527592 19:4766724-4766746 AAGAACAAAGAAAGGAAGGAAGG - Intergenic
1161657923 19:5527120-5527142 CGGATTCAACGAAGGAAGGAAGG - Intergenic
1161709391 19:5839280-5839302 TTGAATAAAAAAGGGATGGAAGG + Exonic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1161806574 19:6447017-6447039 CTGAAAGAAGGAAGGAAGGAAGG + Intronic
1161920013 19:7259036-7259058 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1162135435 19:8552257-8552279 CTCAAAAAAAAAAGGAAGAAGGG - Intronic
1162152197 19:8654688-8654710 TTGAATCAACCAATGAAGGAGGG + Intergenic
1162399142 19:10434160-10434182 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1162504408 19:11074577-11074599 CTTAAAAAAAAAAAGAAGGAAGG + Intergenic
1162539595 19:11286599-11286621 ATAAATAAAAAAAGGAAGGAAGG + Intergenic
1162792079 19:13068385-13068407 CTGAATAAAAGAAGTAAGGTGGG + Intronic
1162859373 19:13494501-13494523 CAGAATAGACAATGAAAGGAAGG + Intronic
1162863207 19:13524050-13524072 TTGAAAGAAGAAAGGAAGGAAGG + Intronic
1162875676 19:13619087-13619109 CGGAAGAAAGGAAGGAAGGAAGG + Intronic
1162883254 19:13676405-13676427 CTGTCCAAAGAAAGGAAGGAAGG + Intergenic
1163093226 19:15035861-15035883 ATGAAGGAAGAAAGGAAGGAGGG + Intergenic
1163235857 19:16030040-16030062 AAGAAAAAAAAAAGGAAGGAAGG + Intergenic
1163240269 19:16058416-16058438 AAGAAAGAACAAAGGAAGGAAGG + Intergenic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1163471462 19:17499804-17499826 CTCTATAAAAAAAGGAAGGAAGG + Intronic
1163499281 19:17666215-17666237 CTGACTCAAAAAAAGAAGGAAGG - Intronic
1163550886 19:17966064-17966086 CTGAAGGAAGGAAGGAAGGAAGG - Intronic
1164283153 19:23786993-23787015 CTTAATAAAGACAGGAAAGATGG + Intronic
1164470395 19:28525180-28525202 CTCAAAAAAAGAAGGAAGGAAGG + Intergenic
1164695194 19:30238586-30238608 CGGAAGAAAGAAAGGAATGAAGG - Intronic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1165151268 19:33761830-33761852 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
1165412537 19:35670713-35670735 CTAGAGAAACAAAGAAAGGAAGG - Intronic
1165438654 19:35811434-35811456 AGGAATAAAGGAAGGAAGGAAGG + Intronic
1165463532 19:35958804-35958826 CAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1165544039 19:36518534-36518556 TAGAATAAAAAAAGGAAGAATGG + Intronic
1165738705 19:38193342-38193364 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
1165738707 19:38193346-38193368 CTCAAAAAAGGAAGGAAGGAGGG + Intronic
1166062406 19:40334931-40334953 GTGAAGAAAGGAAGGAAGGAAGG + Intronic
1166381981 19:42359396-42359418 AAGAAAAAAAAAAGGAAGGAGGG - Intronic
1166711084 19:44937776-44937798 CTCAAAAAACAAAGAAGGGAGGG + Intergenic
1166721998 19:45002064-45002086 CTGACTCAAAAAAGGAAGCAGGG + Intronic
1167248503 19:48388858-48388880 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
1167386028 19:49164342-49164364 CTAAGGAAAGAAAGGAAGGAGGG - Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167755603 19:51411387-51411409 CTGAATGAATGAATGAAGGATGG - Intronic
1167813579 19:51857429-51857451 AAGAAAAAACAAAGAAAGGAAGG + Intronic
925071491 2:971897-971919 CTAAGTAAACAAAGAAAGTAAGG - Intronic
925236178 2:2279559-2279581 ATGAATGAATGAAGGAAGGAAGG + Intronic
925236179 2:2279563-2279585 ATGAATGAAGGAAGGAAGGAAGG + Intronic
925358460 2:3260488-3260510 CTCAAAAAATGAAGGAAGGAAGG + Intronic
925713211 2:6761709-6761731 CTACATAAACAAGTGAAGGAAGG + Intergenic
925749481 2:7074766-7074788 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
925885250 2:8389962-8389984 CACAATAAAGAAAGGAAAGAAGG - Intergenic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
926428010 2:12757351-12757373 CTGAATAAATACACAAAGGAAGG - Intergenic
926475112 2:13312213-13312235 CTGGATAAATAATGGAAGTAAGG - Intergenic
926676339 2:15625140-15625162 CTGAGTAAACACAGCAATGATGG + Intronic
926738465 2:16091935-16091957 ATGATTAAATAAAGGAATGATGG + Intergenic
926775377 2:16416967-16416989 CAGAATTACCAAGGGAAGGAGGG + Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
926824057 2:16884689-16884711 AAGAATGAAAAAAGGAAGGAAGG - Intergenic
926850172 2:17187942-17187964 ATGAATAAACTGAGGATGGAAGG + Intergenic
927094138 2:19734956-19734978 CTCCATAAAGGAAGGAAGGAAGG + Intergenic
927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927377573 2:22436102-22436124 GTGTTTGAACAAAGGAAGGAAGG + Intergenic
927656214 2:24948834-24948856 CTGAATTAGAAAAGGAAGGTGGG - Intronic
927793278 2:26027650-26027672 ATAAATAAATAAAGGAGGGAGGG - Intergenic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928918667 2:36502515-36502537 GTGAAAAAAGGAAGGAAGGAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929379969 2:41337937-41337959 CAGAATAAGGAAGGGAAGGAAGG + Intergenic
929432950 2:41903727-41903749 CTGGATAAAAGAAGGAAGAATGG + Intergenic
929510700 2:42563823-42563845 ATCAAAAAAGAAAGGAAGGAAGG - Intronic
929685159 2:44027044-44027066 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
929854000 2:45620310-45620332 CTCAAAAAAAAAAGAAAGGAAGG + Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930321672 2:49862529-49862551 CTTAGAAAAGAAAGGAAGGAAGG - Intergenic
930586314 2:53271263-53271285 CTGAATAAACTAGGTATGGAAGG + Intergenic
930665869 2:54097899-54097921 AAGAAGAAAGAAAGGAAGGAAGG - Intronic
931077685 2:58734953-58734975 AGGAAGGAACAAAGGAAGGAGGG - Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
931268862 2:60684312-60684334 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
931345800 2:61445000-61445022 CTGTATAAACAATGGAAGCCAGG + Intronic
931411109 2:62032757-62032779 ATGAATGAATGAAGGAAGGAAGG - Intronic
931418839 2:62106854-62106876 ATCAAGAAACAAAGGAAGGGTGG + Intronic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
931892143 2:66685112-66685134 AGGAAAAAACAAAGGAAGGGAGG - Intergenic
931913150 2:66924249-66924271 CAGAATAAAACAAGGGAGGAGGG - Intergenic
932358301 2:71084985-71085007 ATGCACAAACAAAGCAAGGAAGG - Intergenic
932501888 2:72189739-72189761 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
932609086 2:73185411-73185433 TTGAAGAAGCCAAGGAAGGAAGG - Intergenic
932612685 2:73211493-73211515 CTCAAAAAAAAAAGAAAGGAGGG - Exonic
932881480 2:75506150-75506172 CTAAATATCCAAAGGCAGGAAGG - Intronic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933142400 2:78809009-78809031 TTTAAAAAACAAAGAAAGGATGG + Intergenic
933191060 2:79334608-79334630 AAGAATAAAAAAAGGATGGAGGG + Intronic
933362743 2:81308483-81308505 ATGAAAAAAGAAAGGAAGAAAGG - Intergenic
933453161 2:82483148-82483170 ATGAATTAATGAAGGAAGGAAGG - Intergenic
933660689 2:84925205-84925227 ATGCACAAACAAAGCAAGGAAGG - Intergenic
933679093 2:85083232-85083254 AGGAATAAAGGAAGGAAGGAGGG + Intergenic
933799303 2:85947519-85947541 CAGAACAAACCAAGGAATGAGGG - Intergenic
933839358 2:86274151-86274173 CTGCATAAACATAGGAAGAAAGG + Intronic
934706095 2:96482480-96482502 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
934818547 2:97351821-97351843 ATGCACAAACAAAGCAAGGAAGG - Intergenic
934903043 2:98176252-98176274 CAGAAGAAAGGAAGGAAGGAAGG - Intronic
935485356 2:103646582-103646604 ATAAAGAAAGAAAGGAAGGAAGG + Intergenic
935485718 2:103650942-103650964 CTCAAAAAAAGAAGGAAGGAAGG + Intergenic
935616432 2:105087823-105087845 TTGAGGAATCAAAGGAAGGAAGG - Intronic
935663444 2:105489115-105489137 ATGAATGAATGAAGGAAGGAAGG + Intergenic
935809851 2:106786969-106786991 GTGACTAGAAAAAGGAAGGAGGG - Intergenic
935889194 2:107657572-107657594 ATGACTGAAGAAAGGAAGGAAGG + Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
935989825 2:108709253-108709275 ACGAACAAACGAAGGAAGGAAGG + Intergenic
936466960 2:112762269-112762291 GTGAATCTCCAAAGGAAGGAGGG - Intronic
936563394 2:113561855-113561877 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
936589993 2:113794488-113794510 TGGAAGAAAGAAAGGAAGGAAGG + Intergenic
936648244 2:114396667-114396689 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
936679766 2:114757024-114757046 TTGAATATAGGAAGGAAGGAAGG + Intronic
936746734 2:115585568-115585590 AGGAAAAAAGAAAGGAAGGAAGG - Intronic
936763806 2:115819515-115819537 CTGAACAAAAAAAAGAGGGATGG - Intronic
936997743 2:118433111-118433133 AGGAAAAAATAAAGGAAGGAAGG + Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937458246 2:122062634-122062656 ATGAATGAATAAAGGAAAGAAGG - Intergenic
937486499 2:122320671-122320693 ATGACTAGACAAAGGAAGGAAGG - Intergenic
937610002 2:123849869-123849891 AGGAATAAAAAAAGGAAGGAAGG + Intergenic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
938218852 2:129548412-129548434 GTAAATGAAGAAAGGAAGGAAGG - Intergenic
938299380 2:130199211-130199233 CTCAAAAAAAAAAGGAAGAAAGG + Intergenic
938301460 2:130217039-130217061 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
938341917 2:130541475-130541497 CTGAGCCAACACAGGAAGGAGGG + Intronic
938347915 2:130579236-130579258 CTGAGCCAACACAGGAAGGAGGG - Intronic
938424178 2:131170757-131170779 CTCAAAAAAGAAAGAAAGGAAGG - Intronic
938455249 2:131457434-131457456 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
938576826 2:132612189-132612211 TTGATTCTACAAAGGAAGGAAGG - Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
938677028 2:133647366-133647388 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
938928811 2:136067933-136067955 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
938989225 2:136610903-136610925 TGGATTAATCAAAGGAAGGAAGG - Intergenic
939068262 2:137509370-137509392 CAAAATAAATAAAGGAAGAAAGG - Intronic
939138631 2:138326257-138326279 ATAAATAAATAATGGAAGGAAGG + Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939256784 2:139754311-139754333 CTCAAAAAACTAAGGAAAGAAGG - Intergenic
939280462 2:140057890-140057912 ATGAAGGAAGAAAGGAAGGAAGG + Intergenic
939526302 2:143299061-143299083 TTGAAGAAACAATGAAAGGAAGG - Intronic
939599897 2:144175594-144175616 CTTTATATAGAAAGGAAGGAAGG - Intronic
939827751 2:147035395-147035417 CTCAAAAAAAAAAGGAAGGAAGG + Intergenic
939888106 2:147703322-147703344 CTAAAGAAACAAAGGTATGAAGG - Intergenic
940148192 2:150570112-150570134 CTCAATACACAATGCAAGGAGGG + Intergenic
940569442 2:155411345-155411367 ATGCACAAACAAAGCAAGGAAGG - Intergenic
940611982 2:156004671-156004693 CTGAAGAAAGAAAGGAGTGAGGG - Intergenic
940987764 2:160065269-160065291 CTGAATGAGCGAAGGAATGAGGG + Intergenic
941090156 2:161165983-161166005 CTGGAGAAAAAAAGGAAGTAAGG + Intronic
941434490 2:165452431-165452453 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
941521034 2:166543368-166543390 ATAAATAAACAAAAGAAAGAGGG + Intergenic
941565686 2:167103153-167103175 AGGAAGAAAGAAAGGAAGGAGGG + Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941898306 2:170653067-170653089 ATGAAGAAAAAAAGGAAGGGTGG - Exonic
941964447 2:171287053-171287075 ATGGAAAAAGAAAGGAAGGATGG - Intergenic
942013655 2:171789607-171789629 CCGAAAAGACAAAGGAAGGAAGG + Intronic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942217593 2:173737722-173737744 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
942625555 2:177896558-177896580 CCCATTAAACAAAGGCAGGAAGG - Intronic
942664194 2:178299522-178299544 CAAAACAAAGAAAGGAAGGAAGG - Intronic
942671948 2:178385230-178385252 ATAATTAAAGAAAGGAAGGAAGG + Intronic
942671951 2:178385250-178385272 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
942945904 2:181672698-181672720 CTGAATGAAGAAAGGAAGACAGG + Intronic
943227887 2:185204990-185205012 ATGAATAAACAAGGAAAGGAAGG - Intergenic
943418699 2:187638164-187638186 CTGAAGAAAGAAAGAAAGAAAGG + Intergenic
943529850 2:189065526-189065548 CAGAAAAAAAAAAGGAAGAAAGG + Intronic
944058080 2:195544197-195544219 CTGAATAAAAAAAGGGGGGTGGG + Intergenic
944649522 2:201815466-201815488 CTTAATTAGCAAAGGAATGAGGG - Intronic
944673074 2:202012257-202012279 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
944710102 2:202327889-202327911 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
944880120 2:204004474-204004496 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945431989 2:209775301-209775323 TGGAATAAAGAAAGAAAGGAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945584795 2:211647118-211647140 CTCAATAAAATAATGAAGGAGGG + Intronic
946043799 2:216804359-216804381 ATGAAAGAAGAAAGGAAGGAAGG + Intergenic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946352714 2:219165769-219165791 CTAACTAGACAAAGGCAGGAGGG - Intronic
946371219 2:219282618-219282640 AAGAATAAAGGAAGGAAGGAGGG - Intronic
946408104 2:219502937-219502959 ATAAATAAATAAAGGAGGGAGGG - Intronic
946781873 2:223199810-223199832 TAGAATAAATGAAGGAAGGAAGG + Intergenic
946882664 2:224192086-224192108 ATGAAAGAAGAAAGGAAGGAGGG + Intergenic
946899917 2:224362186-224362208 CTCAAAAATGAAAGGAAGGAAGG + Intergenic
947158231 2:227185299-227185321 CTGATCAAACAAAGGATGGGTGG + Intronic
947226908 2:227849374-227849396 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947859251 2:233347321-233347343 AGGAATAAAGGAAGGAAGGAAGG - Intergenic
948041593 2:234905744-234905766 AAAAATAAACAAAGGAAGGAAGG + Intergenic
948496292 2:238352004-238352026 GGGAAGAAACAAAGGCAGGAGGG + Intronic
948582627 2:238998212-238998234 AGGAATAAAGGAAGGAAGGAAGG - Intergenic
948582642 2:238998299-238998321 ATAAATAAATAAATGAAGGAAGG - Intergenic
949069363 2:242014212-242014234 TTGAATAAAAAAAGGAGGGGAGG - Intergenic
1168915518 20:1482514-1482536 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1169493733 20:6093260-6093282 AAGAAGAAACAAATGAAGGAAGG - Intronic
1169980024 20:11374036-11374058 TTGAATAAAGAAAGGAAAAAAGG - Intergenic
1170148023 20:13198902-13198924 CAAAATAAAAAAAGGAAGGAAGG - Intergenic
1170335314 20:15264364-15264386 CTGAATCAAAGAATGAAGGAAGG - Intronic
1170507181 20:17039442-17039464 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171070380 20:22062512-22062534 GTGAATGAAGGAAGGAAGGAAGG + Intergenic
1171423821 20:25036995-25037017 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171769614 20:29312468-29312490 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1171774531 20:29352946-29352968 ATGAAGAAATGAAGGAAGGAGGG - Intergenic
1171816584 20:29790811-29790833 ATGAAGAAAGGAAGGAAGGAAGG - Intergenic
1171974489 20:31585731-31585753 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1172343878 20:34181487-34181509 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1172785511 20:37465841-37465863 CTGAATAAATAAAGCACTGAAGG - Intergenic
1172804686 20:37603430-37603452 AGGAAGAAACAAAGAAAGGAAGG - Intergenic
1172804694 20:37603474-37603496 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1172915253 20:38438682-38438704 ATCAAGAAAGAAAGGAAGGAAGG + Intergenic
1173444657 20:43106690-43106712 ATGAAGGAACAAAGGAAAGAAGG + Intronic
1173484659 20:43431768-43431790 CTACAAAAAAAAAGGAAGGAAGG - Intergenic
1173484836 20:43433377-43433399 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1173662654 20:44745332-44745354 CTGAATGAAAGAAGGAAGGAAGG + Intergenic
1173716497 20:45211494-45211516 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1173716539 20:45211753-45211775 AGGAAGAAACAAAGGAAGGAAGG + Intergenic
1173754314 20:45501599-45501621 CTGAATTATAGAAGGAAGGAAGG - Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173853764 20:46236330-46236352 CTGAATAAAGATCTGAAGGAAGG - Intronic
1173920179 20:46738531-46738553 ATGAATGAAACAAGGAAGGAAGG + Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1173989750 20:47293054-47293076 CCAAAAAAAGAAAGGAAGGAAGG + Intronic
1174062778 20:47844236-47844258 AGGAAGAAACAAAGAAAGGAAGG + Intergenic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174673355 20:52329677-52329699 ATGAACAAACAAAGGAAAAAAGG - Intergenic
1174849022 20:53973787-53973809 CTCAAGAAAGAAAAGAAGGAAGG + Intronic
1174899958 20:54488809-54488831 TTTAATAATAAAAGGAAGGAAGG - Intronic
1174915376 20:54648189-54648211 CTGAGTAAACAAAGAATGGATGG - Intronic
1175344133 20:58259356-58259378 AGGAAAAAACAAAAGAAGGAAGG + Intergenic
1175504583 20:59472611-59472633 ATGAATGAAGAAAGGAAGGGAGG - Intergenic
1175605780 20:60311259-60311281 CTGAATGAAAGAAGGAGGGAGGG - Intergenic
1175666364 20:60863665-60863687 ATAAATAAAGGAAGGAAGGAAGG + Intergenic
1176387209 21:6144385-6144407 CTCAAAAAAAAAAGGAAGGAAGG - Intergenic
1176782283 21:13211228-13211250 AGGAAGAAAAAAAGGAAGGAAGG - Intergenic
1176892255 21:14332329-14332351 ATAAATAAATAAGGGAAGGAGGG + Intergenic
1176939605 21:14908759-14908781 CTAAAGAAAGATAGGAAGGAAGG - Intergenic
1177097365 21:16853127-16853149 AAGAAGAAACAAAGGAAGGAAGG + Intergenic
1177261894 21:18740156-18740178 ATGAATAAAGACAGGAAGAATGG + Intergenic
1177282127 21:18994423-18994445 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178357838 21:31923468-31923490 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1178426033 21:32478996-32479018 CTAAATAAACACAGGTTGGAAGG + Intronic
1178460195 21:32795936-32795958 ATGAAGAAATGAAGGAAGGAAGG - Intronic
1178676379 21:34634906-34634928 CTCAAGAAAGGAAGGAAGGAAGG + Intergenic
1178782681 21:35619928-35619950 AGAAATAAACAAAGGAAAGAAGG - Intronic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179052614 21:37901025-37901047 TTGAACAAAGAAAGGCAGGAAGG - Intronic
1179302657 21:40126263-40126285 AAGAAAAAAGAAAGGAAGGAAGG + Intronic
1179352143 21:40621938-40621960 AAGAAAAAAGAAAGGAAGGAAGG + Intronic
1179373115 21:40825305-40825327 AGGAAGAAAAAAAGGAAGGAAGG - Intronic
1179395211 21:41033511-41033533 AGGAATAAAAGAAGGAAGGAAGG + Intergenic
1179401852 21:41091406-41091428 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
1179644380 21:42766746-42766768 CTGAAAAACCAAGGGAAGGAGGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179736264 21:43393863-43393885 CTCAAAAAAAAAAGGAAGGAAGG + Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1180248477 21:46563985-46564007 CTGAAGCAAAAAGGGAAGGAAGG - Intronic
1180461118 22:15565658-15565680 CTGAATTAAGAAGGGAAGGGAGG + Intergenic
1180490195 22:15838044-15838066 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1180664129 22:17496199-17496221 CTGAAAAATCAAAGAAAGGACGG + Intronic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181565667 22:23735662-23735684 CTTAAAAAAGAAAGAAAGGAAGG + Intergenic
1181737472 22:24893049-24893071 GTCAAGAAAGAAAGGAAGGAAGG + Intronic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181991571 22:26840964-26840986 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1182406494 22:30137481-30137503 CTGTTTCAAAAAAGGAAGGAAGG + Intronic
1182583310 22:31328193-31328215 CTGAATCAACAAGTGAAGGTGGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183162934 22:36126851-36126873 AGGAAGAAACAAAGGAAGGAAGG - Intergenic
1183568776 22:38636066-38636088 AAGAAAAAAGAAAGGAAGGAAGG + Intronic
1183630701 22:39030843-39030865 CTCAATAAAATAAAGAAGGAAGG + Intronic
1183634156 22:39050934-39050956 CTCAATAAAATAAAGAAGGAAGG + Intronic
1183642494 22:39101048-39101070 CTGTATAAACCAGGGAAGGCAGG + Intronic
1183728353 22:39602071-39602093 CTCAAAAAAAGAAGGAAGGAAGG - Intronic
1184020606 22:41818783-41818805 CTGCATAAACCAAGAACGGAAGG - Intronic
1184168868 22:42746965-42746987 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1184621160 22:45678994-45679016 GTGTATAAGCAAAGGAATGAAGG - Intronic
1184750121 22:46480905-46480927 ATGAATGAAGAAATGAAGGATGG - Intronic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
1185122940 22:48983637-48983659 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1185221956 22:49633466-49633488 CTTGAAAAACGAAGGAAGGAAGG - Intronic
949133782 3:537348-537370 CTGAATAATAAAAGGGGGGAGGG + Intergenic
949149009 3:741946-741968 CTGAGTAAAACAAGGAAGGGAGG + Intergenic
949301319 3:2586940-2586962 CTGAAAAATCAAAGGAGGGAAGG - Intronic
949410797 3:3762035-3762057 ATGAATGAATGAAGGAAGGAAGG - Intronic
949411921 3:3774883-3774905 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
949540621 3:5029253-5029275 AAGAAAAAAAAAAGGAAGGAAGG - Intergenic
949634670 3:5969525-5969547 ATAAATAAATAAAGGAAGGAAGG + Intergenic
949634671 3:5969529-5969551 ATAAATAAAGGAAGGAAGGAAGG + Intergenic
949673838 3:6429717-6429739 ATGAAAAAAGAAAGGAAAGAAGG - Intergenic
949705115 3:6807673-6807695 TGAAAGAAACAAAGGAAGGAAGG + Intronic
949741063 3:7235195-7235217 ATGGAAATACAAAGGAAGGAAGG - Intronic
949823308 3:8138652-8138674 GAGAAAAAACGAAGGAAGGAAGG + Intergenic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950668393 3:14511017-14511039 TGGAATGAACAAATGAAGGAGGG - Intronic
951019742 3:17769436-17769458 ATAAATAAATAAAGGAATGAAGG + Intronic
951150119 3:19278512-19278534 GGGAAGGAACAAAGGAAGGAGGG + Intronic
951161746 3:19431156-19431178 CTGAATAAACTAAGTATTGAAGG - Intronic
951186576 3:19720785-19720807 ATGAAGGAACGAAGGAAGGAGGG + Intergenic
951210125 3:19965734-19965756 CCCAAAAAATAAAGGAAGGAAGG - Intronic
951282576 3:20770932-20770954 AAGAATAAAGGAAGGAAGGAAGG + Intergenic
951354454 3:21647321-21647343 ATGAAGAAAGGAAGGAAGGAAGG - Intronic
951354455 3:21647325-21647347 AGGAATGAAGAAAGGAAGGAAGG - Intronic
951544839 3:23814001-23814023 CTGACTGAAGAAAGGAAGTATGG - Intronic
951748697 3:26009152-26009174 ATGAGAAAGCAAAGGAAGGAAGG - Intergenic
951784699 3:26404557-26404579 GTGAAGAGAGAAAGGAAGGAAGG + Intergenic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
952493029 3:33889827-33889849 CTGAATAGATAAGGGAAGAATGG + Intergenic
952558354 3:34559677-34559699 ATGAAAAAAAATAGGAAGGAAGG - Intergenic
952652982 3:35748216-35748238 AGGAATAAAGGAAGGAAGGAAGG + Intronic
952692457 3:36225951-36225973 ATGAATTTATAAAGGAAGGAAGG - Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953203897 3:40803655-40803677 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
953223262 3:40993185-40993207 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
953254921 3:41280559-41280581 CTGAGTAAACAACGAAATGAAGG + Intronic
953459593 3:43072010-43072032 ATGAATATAAGAAGGAAGGAAGG - Intergenic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955117870 3:56023757-56023779 ATGAATGAAAAAAGGAATGAAGG + Intronic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955373873 3:58377831-58377853 CTGATTAAGCAAATGTAGGAAGG + Intronic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
955866130 3:63386619-63386641 GAAAATAAAGAAAGGAAGGAAGG - Intronic
955877505 3:63508231-63508253 GTGAATGAATGAAGGAAGGAAGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955954029 3:64269855-64269877 CACAATAAAGAAAGGAAGGCTGG + Intronic
956213558 3:66825892-66825914 CTGATGCAAAAAAGGAAGGATGG - Intergenic
956232306 3:67030519-67030541 CAGTATAAAAAAAGGAAGGGAGG - Intergenic
956260838 3:67339181-67339203 CTCAATTAACAAAGAAAGGAGGG + Intergenic
956282537 3:67572949-67572971 ATGAATAAACAAGAAAAGGAAGG + Intronic
956357338 3:68408633-68408655 CTGAATAATGAAAGGAAGGAAGG - Intronic
956486024 3:69722721-69722743 CGGAAGGAAAAAAGGAAGGAAGG + Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956737725 3:72251220-72251242 CACAAGGAACAAAGGAAGGATGG + Intergenic
957176109 3:76811869-76811891 CTCAAAAAAGGAAGGAAGGAAGG - Intronic
957305081 3:78447311-78447333 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
957926997 3:86827286-86827308 ATTAAGAAACAATGGAAGGAGGG + Intergenic
958137802 3:89519195-89519217 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958791063 3:98651787-98651809 TGGAATACACAAAGGAAGGGAGG + Intergenic
959112652 3:102140397-102140419 GAGAAAAAAGAAAGGAAGGAAGG - Intronic
959164222 3:102757143-102757165 CTGAAAAAAAAAAAGAAGCAGGG - Intergenic
959250555 3:103937549-103937571 AGAAATAAAAAAAGGAAGGAAGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959364405 3:105438874-105438896 ATAAATAAATGAAGGAAGGAAGG + Intronic
959440248 3:106365459-106365481 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
959445716 3:106436157-106436179 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
959752850 3:109858843-109858865 CTGAATTCCAAAAGGAAGGAGGG + Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961226503 3:125253687-125253709 CTTAATTAACAAATTAAGGAGGG - Intronic
961264826 3:125633454-125633476 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
962057515 3:131887523-131887545 GTGAAAAAACAAATGTAGGAGGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
962694076 3:137930410-137930432 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
962844194 3:139260732-139260754 AGGAAGGAACAAAGGAAGGAAGG + Intronic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
963403855 3:144837852-144837874 CAGAAAAAAAAAAGGAAGGAAGG - Intergenic
963518170 3:146334423-146334445 CCTAAGAGACAAAGGAAGGAGGG + Intergenic
963626355 3:147679024-147679046 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
963777870 3:149458007-149458029 GTAAATTAACAAAGGAAGGGGGG + Intergenic
964052825 3:152417669-152417691 GTGAAAGAACAAATGAAGGAAGG + Intronic
964101785 3:152996130-152996152 CTGTCAAAAGAAAGGAAGGAAGG + Intergenic
964183180 3:153912517-153912539 CTAAATAAACATAGGGAGGCAGG - Intergenic
964667069 3:159186283-159186305 ATGAATAAAGGAAGGAATGAAGG + Intronic
964738724 3:159943417-159943439 CTGAATTAGCACAGAAAGGATGG - Intergenic
965171043 3:165265444-165265466 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
965211659 3:165797360-165797382 AAGAATAAAGGAAGGAAGGAAGG - Intronic
965481153 3:169220935-169220957 ATCAATGAATAAAGGAAGGAAGG + Intronic
965582009 3:170278658-170278680 ATAAATAAATAAATGAAGGAAGG + Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966142293 3:176769796-176769818 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
966223373 3:177572264-177572286 CTGAATAACCAAAGCAAGGTGGG - Intergenic
966422286 3:179745505-179745527 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
966945191 3:184772910-184772932 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
967007328 3:185396761-185396783 CAGAAAAAATAAGGGAAGGAGGG - Intronic
967044012 3:185719831-185719853 CTCAAAAAAGAAAGGAAGGAAGG + Intronic
967232695 3:187355285-187355307 TTGTAGAAACAAAGAAAGGAAGG - Intergenic
967356462 3:188577732-188577754 ACGAAGGAACAAAGGAAGGAAGG - Intronic
967391619 3:188961759-188961781 GGGAAGAAAGAAAGGAAGGAAGG - Intronic
967414948 3:189206031-189206053 CAGAAGAAAGGAAGGAAGGAAGG - Intronic
967435630 3:189442858-189442880 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
967435633 3:189442874-189442896 GTTAAGAAAGAAAGGAAGGAAGG - Intergenic
967543030 3:190691296-190691318 GGGAATAAAGGAAGGAAGGAAGG + Intergenic
967746838 3:193065727-193065749 AAGAATCAGCAAAGGAAGGAAGG + Intergenic
967814362 3:193786789-193786811 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967836549 3:193969093-193969115 CTGAGTGAACTTAGGAAGGAGGG + Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968107357 3:196011033-196011055 TTGAATAAAAAAGGAAAGGAGGG + Intergenic
968211715 3:196854485-196854507 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
968325775 3:197813979-197814001 CTGAGTAAACAATAGATGGATGG - Intronic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
968439541 4:615975-615997 CAGAAGAAAGGAAGGAAGGAAGG - Intergenic
968695123 4:2020898-2020920 ATAAATAAAGGAAGGAAGGAAGG - Intronic
968695124 4:2020902-2020924 AAAAATAAATAAAGGAAGGAAGG - Intronic
969926366 4:10589593-10589615 CTGCAGAAACAAAGCAGGGAGGG + Intronic
969961927 4:10953241-10953263 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
969989253 4:11243661-11243683 ATAAAGGAACAAAGGAAGGAAGG + Intergenic
970072233 4:12173812-12173834 CTGATTATAAAATGGAAGGAAGG - Intergenic
970096605 4:12470320-12470342 ATGAATGAAGGAAGGAAGGAAGG + Intergenic
970297673 4:14648458-14648480 CTGAATGAATAAATAAAGGAAGG - Intergenic
970777199 4:19689387-19689409 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
970837813 4:20432059-20432081 GTGAATGAATGAAGGAAGGAAGG + Intronic
970837814 4:20432063-20432085 ATGAATGAAGGAAGGAAGGAAGG + Intronic
971130994 4:23810545-23810567 ATTAATAAAGAAAGGAAGGGAGG - Intronic
971237304 4:24854414-24854436 ATGAATAAATGAAGAAAGGAGGG + Intronic
971297150 4:25405992-25406014 CTTTCTAAAGAAAGGAAGGAAGG + Intronic
971352720 4:25867315-25867337 ATGAATAAAAAAAGAAAAGAAGG - Intronic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
971627897 4:28946937-28946959 AAGAATAAAAAAAGTAAGGATGG - Intergenic
971782853 4:31060006-31060028 CTGACTAAACAAAGAAAAGCTGG - Intronic
971842243 4:31868582-31868604 CGGAAGGAAGAAAGGAAGGAAGG - Intergenic
971909582 4:32778353-32778375 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
972103208 4:35447748-35447770 ATGAAGGAAAAAAGGAAGGAAGG + Intergenic
972727845 4:41761167-41761189 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
972785885 4:42326580-42326602 ATGAAGAAAGAATGGAAGGAAGG + Intergenic
972789497 4:42357357-42357379 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
972875675 4:43356768-43356790 ATAAATAAATAAAGGAATGAAGG + Intergenic
973124462 4:46567016-46567038 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
973167212 4:47092532-47092554 ATGAATAAATAAAGGAAAGAAGG + Intronic
973213262 4:47639556-47639578 CTGAATGTACAAAGGCAGGCTGG + Intronic
973611863 4:52643659-52643681 CTGAATAAACTTGGGAAGCAGGG + Intronic
973794950 4:54415829-54415851 ATGCACAAACAAAGCAAGGAAGG + Intergenic
973800015 4:54468402-54468424 CTACATAAAGAAAGGAAGAATGG - Intergenic
973843973 4:54892202-54892224 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
973852495 4:54974931-54974953 TTGAATTTACAAAGGAAGGGAGG - Intergenic
973996487 4:56464377-56464399 GTGAATACACAAAAGTAGGAAGG + Intergenic
974407564 4:61495441-61495463 ATGAAAGAAAAAAGGAAGGAAGG + Intronic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
974787502 4:66638701-66638723 TTGAATAGAAATAGGAAGGAAGG + Intergenic
974831467 4:67194682-67194704 CAAAATAAAGGAAGGAAGGAAGG + Intergenic
974845671 4:67348609-67348631 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
974963679 4:68734665-68734687 ATGAAGAAAGACAGGAAGGAAGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975120206 4:70720068-70720090 CAAAATAAAAAAAAGAAGGAGGG - Intronic
975226218 4:71876139-71876161 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
975543838 4:75541602-75541624 GAGAATAAAAAAAGGAAAGAAGG + Intronic
975570199 4:75808690-75808712 AGGAAGAAAGAAAGGAAGGATGG - Intronic
975642624 4:76515383-76515405 CTGAAAAAAAAAAGGAAGGAAGG + Intronic
975686379 4:76919790-76919812 CAGAAGAAAGAAAGGAAGAAAGG - Intergenic
975866102 4:78725364-78725386 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
976558120 4:86472995-86473017 ATGCACAAACAAAGCAAGGAAGG - Intronic
976771610 4:88659185-88659207 CTGAATAAAAGCAGGAAGGGTGG - Intronic
976986198 4:91301974-91301996 GGAAATAAACGAAGGAAGGAAGG - Intronic
977274685 4:94962131-94962153 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
977345001 4:95806725-95806747 TCGAATGAATAAAGGAAGGAAGG - Intergenic
977369821 4:96121411-96121433 CAGAAGCAACATAGGAAGGAGGG + Intergenic
977416884 4:96744222-96744244 GGGAATAAAGGAAGGAAGGAGGG - Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977829343 4:101571866-101571888 CTGAATGAATAAATGAATGAAGG + Intronic
977899423 4:102402275-102402297 ATGGATGAAGAAAGGAAGGAAGG + Intronic
977899424 4:102402279-102402301 ATGAAGAAAGGAAGGAAGGAAGG + Intronic
977960415 4:103078650-103078672 ATAAATGAACAAAGGTAGGAAGG - Intronic
977982095 4:103336417-103336439 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
978033670 4:103969232-103969254 CTCAAAAATAAAAGGAAGGAAGG - Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978485355 4:109247341-109247363 CTGAAAAAAAAAGGAAAGGAGGG + Intronic
978541259 4:109818546-109818568 AGGAAAAAAGAAAGGAAGGAAGG - Intronic
978541551 4:109821550-109821572 CTGAACACACAAAGTAATGAAGG - Intronic
978581165 4:110232601-110232623 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
978718782 4:111879217-111879239 CTGAAGAAAGGAAGGAAGGAAGG - Intergenic
978823540 4:112993305-112993327 CTGTCTAAAAAAAGAAAGGAAGG - Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979056135 4:115997513-115997535 GAAAATAAAGAAAGGAAGGAAGG + Intergenic
979056138 4:115997535-115997557 GAAAATAAAGAAAGGAAGGAAGG + Intergenic
979101071 4:116615350-116615372 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
979101083 4:116615410-116615432 ATGAGGGAACAAAGGAAGGAAGG + Intergenic
979101099 4:116615486-116615508 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
979101107 4:116615518-116615540 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
979101116 4:116615558-116615580 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
979101127 4:116615598-116615620 AGGAAGGAACAAAGGAAGGAGGG + Intergenic
979625847 4:122844606-122844628 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
979633155 4:122925887-122925909 CTGAATGAATAAATGAAGGGTGG + Intronic
979829616 4:125283119-125283141 ATAAACAAACAAAAGAAGGATGG + Intergenic
979982931 4:127278377-127278399 CTGAATGAAGAAAGGAAATAAGG - Intergenic
980078623 4:128320528-128320550 AAGAAGAAAGAAAGGAAGGAGGG - Intergenic
980223561 4:129951069-129951091 GGGAAGAAAGAAAGGAAGGAAGG + Intergenic
980244095 4:130215434-130215456 CTGAATAAAAGAATGAATGACGG + Intergenic
980332310 4:131425919-131425941 CGAAAGAAAGAAAGGAAGGAAGG + Intergenic
980332333 4:131426051-131426073 AGGAAAAAAAAAAGGAAGGATGG + Intergenic
980403226 4:132320995-132321017 ATGAAGGAAGAAAGGAAGGAAGG - Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981030395 4:140119618-140119640 CTAAAAAAAAAAAGGAAGGGAGG - Intronic
981512952 4:145577237-145577259 CTGGATAAATAATGGAATGAAGG + Intergenic
981601263 4:146491638-146491660 GTGAAGAAAGAAAGGAAGGAGGG + Intronic
981982010 4:150805170-150805192 AAGAAAAAAAAAAGGAAGGAAGG + Intronic
982183916 4:152777539-152777561 AGGAAGAAAAAAAGGAAGGAAGG + Intronic
982349179 4:154396244-154396266 AAGAAGAAACAAAGGAAGGGAGG + Intronic
982448164 4:155519122-155519144 GTAAAGAAACAAAGGGAGGAGGG + Intergenic
982697098 4:158614843-158614865 ATGATTAAACATAGTAAGGAAGG - Intronic
982806428 4:159770960-159770982 ATGAATAAATAAAGGAAGTAAGG + Intergenic
982998626 4:162383197-162383219 ATGAATACACAAAGGTAGGGAGG + Intergenic
983012545 4:162564915-162564937 ATGAAAGAAGAAAGGAAGGAAGG + Intergenic
983208120 4:164932291-164932313 GTGCACAAACAAAGCAAGGAAGG + Intergenic
983213628 4:164982226-164982248 CTGGTTAAAAAAAGGAGGGATGG + Intergenic
983273247 4:165587988-165588010 GTTAATAAACAAAGGATAGATGG - Intergenic
983403799 4:167299552-167299574 CAGAAAAAAGGAAGGAAGGAAGG + Intergenic
983418970 4:167494400-167494422 TCTAATAAAAAAAGGAAGGAAGG - Intergenic
983435960 4:167715778-167715800 AGGAATAAAGGAAGGAAGGAAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984149365 4:176107841-176107863 AGGAAGAAAAAAAGGAAGGAAGG - Intronic
984494932 4:180484692-180484714 TTGAAGGAAGAAAGGAAGGAAGG - Intergenic
984720826 4:182970971-182970993 GGGAATAAAGGAAGGAAGGAGGG + Intergenic
984720846 4:182971064-182971086 GGGAATAAAGGAAGGAAGGAGGG + Intergenic
984762567 4:183375798-183375820 CTTAATAAGGAAAGAAAGGAAGG + Intergenic
984973872 4:185212949-185212971 AAGAAAAAACAAGGGAAGGAAGG - Intronic
985134764 4:186775159-186775181 GTGATTAGTCAAAGGAAGGAAGG - Intergenic
985240187 4:187922929-187922951 ATGAATGAGTAAAGGAAGGAAGG - Intergenic
985364947 4:189219386-189219408 CTGAAGGAAGAAAGGAAAGAAGG + Intergenic
985387188 4:189460665-189460687 AAGAAGAAAAAAAGGAAGGAAGG + Intergenic
986573870 5:9192522-9192544 GTGAATAAACAAAGAAGGGAAGG + Intronic
986862851 5:11948232-11948254 ATGAAGGAACGAAGGAAGGAAGG - Intergenic
986991179 5:13554565-13554587 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
986994290 5:13589299-13589321 CTGAATAAATAAATAAAGGGAGG + Intergenic
987191417 5:15482394-15482416 CTGAGTAGAAAAAGGAGGGAGGG + Intergenic
987233341 5:15917692-15917714 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
987316886 5:16732210-16732232 CCAAAGAAACAAAGGAAGGAAGG + Intronic
987335841 5:16896922-16896944 CCGAACAAAGGAAGGAAGGAAGG + Intronic
987350901 5:17020895-17020917 ATGCACAAACAAAGCAAGGAAGG + Intergenic
987363165 5:17124910-17124932 ACGAAGGAACAAAGGAAGGAAGG - Intronic
987580863 5:19790338-19790360 TTAAATATATAAAGGAAGGAAGG - Intronic
987677643 5:21095638-21095660 GTCAATAAAAGAAGGAAGGAAGG - Intergenic
987695275 5:21320565-21320587 CTAAATTAACAAAAGAAGGAAGG - Intergenic
987841706 5:23231060-23231082 ATGCACAAACAAAGCAAGGAAGG + Intergenic
988244464 5:28661548-28661570 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
988644664 5:33081150-33081172 GTGAAGAAAGAAAGGAAGGGAGG - Intergenic
989237603 5:39166955-39166977 ATAAATAAAAAAAGAAAGGAGGG + Intronic
989248670 5:39282218-39282240 GGGAATGAAGAAAGGAAGGAAGG - Intergenic
989346063 5:40430695-40430717 ATGAACAACCAAAGGAAGAAGGG - Intergenic
989970985 5:50523688-50523710 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
990165155 5:52986622-52986644 CGGGATAAACAAAGGAGGGCAGG + Intergenic
990186261 5:53213048-53213070 CTGGATATGGAAAGGAAGGAAGG + Intergenic
990683034 5:58267411-58267433 GTGAATAAATGAAGGAAGGAAGG + Intergenic
990797183 5:59556840-59556862 ATGAATAAAGAAAGGATGGAAGG + Intronic
991006547 5:61833273-61833295 ATGAATGAATGAAGGAAGGAAGG + Intergenic
991006548 5:61833277-61833299 ATGAATGAAGGAAGGAAGGAAGG + Intergenic
991331175 5:65494041-65494063 ATGAATGAATGAAGGAAGGAAGG - Intergenic
991385001 5:66077324-66077346 CTGAATGAACAAAGAAAAGGAGG - Intronic
991390781 5:66141459-66141481 CTCAAAAAAGAAAGGAAGGAAGG - Intronic
991598141 5:68325316-68325338 AAGAAGAAACCAAGGAAGGAAGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
992016053 5:72576354-72576376 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
992145009 5:73837718-73837740 CGAAAGAAAGAAAGGAAGGAAGG - Intronic
992161734 5:74011006-74011028 ATGAATAAATGAAGGAAGAAGGG + Intergenic
992186429 5:74249009-74249031 AGGAAGGAACAAAGGAAGGAAGG + Intergenic
992343094 5:75846514-75846536 ATGAAGGAAGAAAGGAAGGAAGG - Intergenic
992541843 5:77773764-77773786 ATCAATAAACAAAGGAAAGGTGG + Intronic
993187492 5:84637891-84637913 AGGAAAAAAGAAAGGAAGGAAGG - Intergenic
993232562 5:85255578-85255600 TTGAACAAACAAAAGAGGGAGGG - Intergenic
993256807 5:85601799-85601821 AAGAAGGAACAAAGGAAGGAAGG - Intergenic
993753877 5:91703272-91703294 CTGAATAAACATGGGAAGGGAGG - Intergenic
993912581 5:93702612-93702634 CTGAATAAATGAAGGAAAGAAGG + Intronic
993935387 5:93994281-93994303 CTGAATAAAGAAAGAAAATATGG + Intronic
994075425 5:95644539-95644561 CTAAAAGAACAAATGAAGGAAGG + Intergenic
994196603 5:96929480-96929502 AAGAAGAAAGAAAGGAAGGAAGG - Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994567612 5:101471292-101471314 AGGAAGAAAGAAAGGAAGGATGG + Intergenic
994856767 5:105131473-105131495 AGGAAAAAAGAAAGGAAGGAGGG - Intergenic
994918583 5:106011786-106011808 AGGAATGAAGAAAGGAAGGAAGG + Intergenic
994918584 5:106011790-106011812 ATGAAGAAAGGAAGGAAGGAAGG + Intergenic
995020760 5:107364937-107364959 CTTAATTCACAAAGGAAGCATGG - Intergenic
995027997 5:107446877-107446899 ATAAATACACAAAGGAAGGGTGG + Intronic
995031553 5:107487473-107487495 ATGAATGAATAAAGGAAAGAAGG + Intronic
995335487 5:110994041-110994063 CTTAATGAAAAAAAGAAGGAAGG + Intergenic
995409252 5:111836065-111836087 ATGAATGAACGAAGGGAGGAAGG - Intronic
995410791 5:111854981-111855003 CTGAATAAACATTGGTAGGGAGG - Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995567989 5:113451716-113451738 CTCAAAAAAAGAAGGAAGGAAGG + Intronic
996120395 5:119665408-119665430 ATGCACAAACAAAGCAAGGAAGG + Intergenic
996561327 5:124832694-124832716 ATGACTAAACAAAGGAAAAAGGG + Intergenic
996592015 5:125158620-125158642 TTAAAGAAAAAAAGGAAGGAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997269210 5:132522361-132522383 CTGAAAGAAGGAAGGAAGGAAGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997577647 5:134994938-134994960 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
997988126 5:138520810-138520832 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
998534935 5:142920949-142920971 CTCAATAAAATAAGGAAGGAAGG - Intronic
998685511 5:144519728-144519750 CTGAATAAACAAAGTGGGCAAGG - Intergenic
999501777 5:152154090-152154112 TAGGATCAACAAAGGAAGGAGGG + Intergenic
999585385 5:153084059-153084081 TTTAACAAAAAAAGGAAGGAAGG - Intergenic
999663526 5:153890111-153890133 GTGAATAACCAAATGAATGAAGG - Intergenic
999916511 5:156268590-156268612 CTCAAAATAGAAAGGAAGGAAGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000464641 5:161560627-161560649 CACAAGAAACAAAGGAAGAAGGG + Intronic
1000576574 5:162982411-162982433 CAGAAAGAACAAAGGAAGAAAGG + Intergenic
1000698500 5:164419097-164419119 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1000962505 5:167616636-167616658 CTGAAGAAATAAGGGAAGGGAGG + Intronic
1001365318 5:171132306-171132328 GGGAAGGAACAAAGGAAGGAAGG + Intronic
1001572767 5:172741374-172741396 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1001574157 5:172751052-172751074 TTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1001678917 5:173541820-173541842 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1001715173 5:173809697-173809719 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1001846894 5:174930119-174930141 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1001957833 5:175860407-175860429 AAAAATAAAGAAAGGAAGGAAGG + Intronic
1002046520 5:176544332-176544354 AAGAAAAAAGAAAGGAAGGAAGG - Intronic
1002399333 5:178982758-178982780 ATGAATGAACAAAGTAAGAAGGG + Intronic
1002550515 5:179987150-179987172 TAGAAGAAAGAAAGGAAGGAAGG - Intronic
1002931163 6:1636206-1636228 CCAAATAAACACAGGAAAGAGGG + Intronic
1003083928 6:3045881-3045903 ATGAATGAACAAATAAAGGATGG + Intergenic
1003140292 6:3465743-3465765 CTGAATGAACGAACAAAGGAAGG + Intergenic
1003140293 6:3465747-3465769 ATGAACGAACAAAGGAAGGATGG + Intergenic
1003465965 6:6380280-6380302 AGGAAAAAAGAAAGGAAGGAAGG - Intergenic
1003541512 6:7022446-7022468 TGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003609037 6:7591621-7591643 CTGAGTAAACAATGTATGGAAGG - Intronic
1003699067 6:8442031-8442053 AAGAACAAACAAATGAAGGAGGG + Intergenic
1003759680 6:9162721-9162743 ATGAAAGAAAAAAGGAAGGAAGG + Intergenic
1003970705 6:11296609-11296631 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1004036656 6:11931041-11931063 CAAAAAAAAAAAAGGAAGGAAGG + Intergenic
1004107247 6:12677219-12677241 CTGTATCAAGGAAGGAAGGAAGG - Intergenic
1004197534 6:13518479-13518501 CTGAATAAAAAAAGAAAAGTCGG + Intergenic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1004213774 6:13681859-13681881 CTCAAAAAAAAAAGGAAAGAAGG - Intronic
1004377302 6:15101989-15102011 ACAAATAAAGAAAGGAAGGAAGG - Intergenic
1004380262 6:15126700-15126722 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1004387497 6:15185305-15185327 CTCCATCAAGAAAGGAAGGAAGG + Intergenic
1004602367 6:17162711-17162733 CAAAAAAAAAAAAGGAAGGAAGG + Intergenic
1004632559 6:17436129-17436151 CTCTATCAAGAAAGGAAGGAAGG - Intronic
1004893943 6:20128267-20128289 CTGAAAAAAGATAGGAAGTAGGG - Intronic
1004921988 6:20384364-20384386 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1005318430 6:24627503-24627525 CAGAAGAAAACAAGGAAGGAAGG - Intronic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1005468270 6:26136724-26136746 GTGAAGAAAGAAAGGAAGGGAGG - Intronic
1005874539 6:30000947-30000969 GTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1005888748 6:30118919-30118941 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1006288470 6:33116227-33116249 CTGTAGAAAGAAAGGAAGAAAGG + Intergenic
1007013269 6:38438162-38438184 CAGGAAAAAAAAAGGAAGGAAGG + Intronic
1007261717 6:40568719-40568741 CTCAAAAAAGGAAGGAAGGAAGG - Intronic
1007334379 6:41141804-41141826 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1007428366 6:41761583-41761605 CTGAATGAACAACTGAGGGAAGG - Intergenic
1007532221 6:42553282-42553304 AAGAAAAAACGAAGGAAGGAAGG + Intergenic
1007874420 6:45079487-45079509 AGGAAGAAAAAAAGGAAGGAAGG + Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008443150 6:51556044-51556066 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008746438 6:54674993-54675015 CTCAAAAAAGAAAGAAAGGAAGG + Intergenic
1008840365 6:55895521-55895543 CTAAATATACAAAGGAAATAAGG - Intergenic
1009025439 6:57993757-57993779 CTAATTAAAAAAAGGAATGAAGG - Intergenic
1009201000 6:60745206-60745228 CTAATTAAAAAAAGGAATGAAGG - Intergenic
1009428532 6:63540996-63541018 CTGTCAAAAAAAAGGAAGGAGGG + Intronic
1009428535 6:63541016-63541038 GGGAATGAAGAAAGGAAGGAAGG + Intronic
1009428536 6:63541020-63541042 ATGAAGAAAGGAAGGAAGGAAGG + Intronic
1009487414 6:64241916-64241938 CTGAATAAATAACGAAATGAAGG - Intronic
1009648535 6:66442540-66442562 CTGAATAAACAGAGGAGAGTAGG - Intergenic
1009781203 6:68273356-68273378 AGGAATAAAGGAAGGAAGGAGGG + Intergenic
1009840452 6:69066372-69066394 GTGAAAAAAAAAAGGAAGAATGG + Intronic
1009956314 6:70458799-70458821 CTGAAAAAACAAGGCAAAGAAGG + Intronic
1010083997 6:71894443-71894465 CTGAAAAAAAAAAGGAAATAAGG + Intronic
1010111331 6:72237227-72237249 GAGAAAAAAAAAAGGAAGGAAGG + Intronic
1010352670 6:74893446-74893468 AGGAATAAAAAAAGGAAGGAAGG + Intergenic
1010609542 6:77937139-77937161 CGTAATAAAGAATGGAAGGAAGG + Intergenic
1010800463 6:80168650-80168672 CTTAAGAAAGAAAGGAAGGGAGG + Intronic
1010848213 6:80738465-80738487 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
1010928870 6:81776514-81776536 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1011016492 6:82761616-82761638 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1011071320 6:83388082-83388104 CCAAAAAAAAAAAGGAAGGAAGG - Intronic
1011176433 6:84565870-84565892 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1011473644 6:87732017-87732039 CTGAAGAAACATAGCAGGGAAGG + Intergenic
1011641232 6:89418186-89418208 AAGAAAAAAAAAAGGAAGGAAGG + Intergenic
1011712502 6:90068977-90068999 CAAAATAATCAAAGGAAGAAAGG - Intronic
1011946684 6:92913643-92913665 CGGAAGGAAGAAAGGAAGGAAGG - Intergenic
1012030488 6:94054237-94054259 ATGAAAAAACAATGTAAGGAGGG + Intergenic
1012184515 6:96196415-96196437 AATAATAAACAAAGGAGGGACGG + Intronic
1012378150 6:98587372-98587394 AGGAAGAAACAAAGGAAGGAAGG - Intergenic
1012392386 6:98757271-98757293 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1012471538 6:99578038-99578060 CTATATAAACAAAGGAAATAAGG - Intergenic
1012943634 6:105443041-105443063 AAAAATAAAAAAAGGAAGGAAGG - Intergenic
1012982806 6:105847619-105847641 GAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1013241325 6:108248759-108248781 CTCAAAAAAAAAAGAAAGGAAGG - Intronic
1013674989 6:112448914-112448936 CAAAAAAAAGAAAGGAAGGAAGG - Intergenic
1013733983 6:113204708-113204730 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1013807125 6:114008450-114008472 ATGCACAAACAAAGCAAGGAAGG + Intronic
1013989138 6:116233337-116233359 ATGAATGAAGAAAAGAAGGAGGG - Intronic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014002514 6:116380639-116380661 AAGAATATACAAAGAAAGGAAGG - Intronic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014128745 6:117807146-117807168 CTCAATAAACAAGGTATGGATGG - Intergenic
1014171963 6:118288670-118288692 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1014351563 6:120352631-120352653 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1014377680 6:120696396-120696418 CGGAAGGAAGAAAGGAAGGAAGG + Intergenic
1014491349 6:122065547-122065569 TTGAATAAATATACGAAGGAAGG + Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014796841 6:125734736-125734758 CTGAATACTGCAAGGAAGGAAGG + Intergenic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1015323401 6:131901291-131901313 TGGAATAAAAGAAGGAAGGAGGG - Intergenic
1015387948 6:132647547-132647569 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1015387955 6:132647678-132647700 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1015600804 6:134908726-134908748 TGAAAAAAACAAAGGAAGGAAGG + Intergenic
1015774746 6:136802449-136802471 TAGAAAAAAAAAAGGAAGGAAGG + Intergenic
1015908917 6:138147196-138147218 CTTAATAAACCAAAGAAGAAGGG - Intergenic
1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017157110 6:151332375-151332397 CTGAATATACCCAAGAAGGAGGG - Intronic
1017378285 6:153797090-153797112 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017560960 6:155627665-155627687 CAAAAGAAATAAAGGAAGGAAGG + Intergenic
1017644826 6:156529213-156529235 ATGAAGAAAAGAAGGAAGGATGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017875900 6:158524098-158524120 AAAAATCAACAAAGGAAGGAAGG + Intergenic
1018061271 6:160091762-160091784 TTGATTAAAGGAAGGAAGGAAGG + Intronic
1018080055 6:160251514-160251536 CAGAAGGAAAAAAGGAAGGAAGG - Intronic
1018086657 6:160306862-160306884 ATGAAGAAAGAAAGGATGGAAGG + Intergenic
1018319339 6:162590441-162590463 CTTAATAAAAAAAAGAAAGATGG - Intronic
1018420708 6:163638690-163638712 CAAAAAAAAAAAAGGAAGGAAGG - Intergenic
1018506084 6:164471116-164471138 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1019067805 6:169317079-169317101 CTGATTGAAGAAAGAAAGGAGGG + Intergenic
1019493116 7:1324261-1324283 ATGAACAAATGAAGGAAGGAAGG - Intergenic
1019493117 7:1324265-1324287 GTAAATGAACAAATGAAGGAAGG - Intergenic
1019493123 7:1324314-1324336 CTGAAAAAACAAAGACAGGTGGG - Intergenic
1019505869 7:1390529-1390551 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1019558287 7:1643245-1643267 CTGATGAAAGGAAGGAAGGAAGG - Intergenic
1019886245 7:3908590-3908612 CGGAATATTTAAAGGAAGGAAGG - Intronic
1019941871 7:4298262-4298284 TTGAAGAAAGAAGGGAAGGATGG - Intergenic
1019989252 7:4680999-4681021 GGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1021112428 7:16710584-16710606 CTGAAGGAAAGAAGGAAGGAAGG + Intergenic
1021127005 7:16862659-16862681 CTTACTAAACAAAGAAAGTATGG + Exonic
1021473137 7:21029293-21029315 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1021494873 7:21263400-21263422 AGGAATAAACATTGGAAGGAGGG + Intergenic
1021760702 7:23900784-23900806 CTAAATAAATAAAGGGAGGGAGG - Intergenic
1021983793 7:26080190-26080212 CGAAAGAAAGAAAGGAAGGAAGG + Intergenic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1023178650 7:37458585-37458607 CTGAGCAAACAAAGGAAGAAAGG - Intergenic
1023258998 7:38340073-38340095 ATGAAAAAAGGAAGGAAGGAAGG + Intergenic
1023484166 7:40666345-40666367 CTCAAGAAAGAAAGGAAGGAAGG + Intronic
1023763858 7:43492435-43492457 CTGAATAGAATAAGGAAGAAAGG - Intronic
1023903097 7:44499422-44499444 CAAAAAAAAGAAAGGAAGGAAGG + Intergenic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024294085 7:47829015-47829037 CTGAATAAAAGAAGGAAGAAAGG + Intronic
1024329228 7:48139828-48139850 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1024343049 7:48286503-48286525 CTGAAAAAAGGAAGGAAGGAAGG - Intronic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1024491579 7:49991567-49991589 GAGAAAAAACAAAGGAAGAATGG - Intronic
1024876298 7:54028024-54028046 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1025231617 7:57206667-57206689 ATGAAGAAAGGAAGGAAGGAAGG - Intergenic
1025843308 7:65172227-65172249 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1025879735 7:65523740-65523762 CTGGAGAAAGAAAGGAAGGAAGG + Intergenic
1025893702 7:65678850-65678872 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1025948600 7:66124539-66124561 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1026296598 7:69058275-69058297 TAGAATGAATAAAGGAAGGAAGG + Intergenic
1026333078 7:69370121-69370143 TTGAATGAATAAATGAAGGAAGG - Intergenic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026492104 7:70872087-70872109 GGGAATAAAAGAAGGAAGGAAGG + Intergenic
1026870585 7:73848843-73848865 CTCCATCAAGAAAGGAAGGAAGG - Intergenic
1027334895 7:77139874-77139896 ATAAAGAAAGAAAGGAAGGAAGG - Intronic
1027398138 7:77778557-77778579 CTGAATCAACTGAGGAGGGAAGG + Exonic
1027553538 7:79632811-79632833 AGGAAGAAACAAAGGAAGGAAGG - Intergenic
1027696063 7:81411936-81411958 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1027938027 7:84633845-84633867 CACAATAAACAAAGAAAGGCAGG + Intergenic
1027951089 7:84817126-84817148 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028712883 7:93930217-93930239 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1028751217 7:94385017-94385039 TTGAATGAAGGAAGGAAGGAAGG + Intergenic
1029162267 7:98560930-98560952 GAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1029368457 7:100131870-100131892 CTAAAAAAAGAAAGGAAGGAAGG - Intergenic
1029462115 7:100701242-100701264 CAGAAAAAAGGAAGGAAGGAGGG - Intergenic
1029575496 7:101400870-101400892 CTGAATGAACAAGTGAAGGAAGG - Intronic
1029636124 7:101785363-101785385 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1029804490 7:102982132-102982154 CTGAATCAACAAGCGAAGAAGGG - Intronic
1029960134 7:104681619-104681641 CTCAAAAAAAAAAGGAAGGGAGG + Intronic
1030070300 7:105692445-105692467 CTCAAAAAAAGAAGGAAGGAAGG - Intronic
1030211934 7:107005507-107005529 CCGAATAAATAATGGAAGGAGGG + Intergenic
1030525082 7:110643043-110643065 AGGAATAAAGGAAGGAAGGAAGG + Intergenic
1030740552 7:113104047-113104069 CTCAAAAATTAAAGGAAGGAAGG - Intergenic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1030949401 7:115770622-115770644 TTGAAGAAATAAAGGAAGAAAGG - Intergenic
1031014234 7:116555438-116555460 CCAAAAAAAGAAAGGAAGGAAGG + Intronic
1031131974 7:117843338-117843360 CTAAATAAAGCAAGAAAGGATGG + Intronic
1031306506 7:120133458-120133480 CTAAAAAAATACAGGAAGGAAGG + Intergenic
1031419207 7:121529594-121529616 AGGAAAAAAGAAAGGAAGGAAGG - Intergenic
1031445845 7:121852665-121852687 ATGAATAAATAAATAAAGGAAGG + Intergenic
1031515037 7:122690153-122690175 CTGAAACAACAAAGCAAGCACGG + Intronic
1031779970 7:125948360-125948382 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1031998000 7:128245524-128245546 ATGAAGAAAGGAAGGAAGGAAGG + Intronic
1032150194 7:129422392-129422414 CTGAAGAAACAAAGAAAAAAAGG - Intronic
1032292546 7:130601817-130601839 TATAATAAAAAAAGGAAGGAAGG + Intronic
1032824257 7:135553863-135553885 GTGAATAAGGAAGGGAAGGAAGG + Intergenic
1032825188 7:135561887-135561909 AGGAAGGAACAAAGGAAGGAAGG - Intronic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1032935878 7:136730877-136730899 CTGAATCAACAAGGAAATGAAGG + Intergenic
1032974509 7:137206978-137207000 CAGAAAAAAGAAGGGAAGGAAGG - Intergenic
1033034205 7:137857034-137857056 CTCAATAAACTAAGGATAGAGGG + Intergenic
1033062022 7:138118766-138118788 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
1033124774 7:138698066-138698088 GGGAAAAAAGAAAGGAAGGAGGG + Intronic
1033254059 7:139784251-139784273 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033801106 7:144903404-144903426 ATGAATTAACAAAGGAATGTGGG - Intergenic
1033883710 7:145918161-145918183 AAGAAGGAACAAAGGAAGGAAGG + Intergenic
1034012371 7:147543528-147543550 CAGAACAAACAAAGGAAAGTAGG - Intronic
1034066054 7:148137659-148137681 CTCAGAAAAAAAAGGAAGGAAGG + Intronic
1034251418 7:149693673-149693695 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1034289321 7:149916106-149916128 ATGAAGAAACCAAGGAATGAAGG - Intergenic
1034605296 7:152307268-152307290 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
1034661748 7:152776720-152776742 ATGAAGAAACCAAGGAATGAAGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035482393 7:159197944-159197966 AGGAATAAATAAAGGAAGGAAGG - Intergenic
1035578706 8:725859-725881 CTGAATGAATGAACGAAGGAGGG - Intronic
1035774607 8:2178594-2178616 GTCAAAAAAAAAAGGAAGGAAGG - Intergenic
1035851053 8:2919688-2919710 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1035945756 8:3959882-3959904 CTAAATAATAAAAGGAATGAAGG - Intronic
1036058833 8:5291439-5291461 AAAAATAAAGAAAGGAAGGAAGG - Intergenic
1036760347 8:11504322-11504344 CAAAATAAAGAAAGGAAGGGAGG + Intronic
1036978957 8:13446940-13446962 CTCAAAAAAAAAAAGAAGGAAGG + Intronic
1037045684 8:14300237-14300259 CTAAATACAGGAAGGAAGGAAGG + Intronic
1037480594 8:19301984-19302006 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037754927 8:21704468-21704490 CAGAATAAATAATGGAGGGAAGG + Intronic
1037914588 8:22765140-22765162 CAGAAGAAAGAAAGGAAGGAAGG - Intronic
1037918899 8:22790200-22790222 GTGAATGAAGGAAGGAAGGAAGG - Intronic
1038503942 8:28068125-28068147 AGGAAGAAAGAAAGGAAGGAGGG + Intronic
1038535964 8:28352930-28352952 CTGCAGAAACACAGGAAAGAAGG + Intronic
1039061967 8:33579217-33579239 ATGAAGAAAGGAAGGAAGGAAGG - Intergenic
1039061968 8:33579221-33579243 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
1039066734 8:33615260-33615282 CAAAAAAAAGAAAGGAAGGAAGG - Intergenic
1039104722 8:33977939-33977961 CTTGAAAAACACAGGAAGGAAGG - Intergenic
1039175378 8:34798459-34798481 ATGAAAGAAGAAAGGAAGGAAGG - Intergenic
1039197491 8:35048598-35048620 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1039428567 8:37506724-37506746 ACAAATGAACAAAGGAAGGAAGG + Intergenic
1039480233 8:37867710-37867732 AAGAAAAAAAAAAGGAAGGAAGG + Intronic
1039716418 8:40114444-40114466 CAAAAAAAAGAAAGGAAGGAAGG - Intergenic
1039872536 8:41559058-41559080 CTCAAAAAAGGAAGGAAGGAAGG - Intergenic
1040417581 8:47208732-47208754 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1040482641 8:47840882-47840904 CTGAATAGACATAGCCAGGAGGG + Intronic
1040581321 8:48700908-48700930 CTTAGTCGACAAAGGAAGGATGG + Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1040629290 8:49191107-49191129 AAGAAAGAACAAAGGAAGGAAGG - Intergenic
1040666969 8:49645398-49645420 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1040837087 8:51743967-51743989 GAGAAAAAAGAAAGGAAGGAAGG + Intronic
1040903562 8:52441662-52441684 CTCAAAAAAAAAAAGAAGGAAGG + Intronic
1041155747 8:54985245-54985267 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
1041643961 8:60232284-60232306 CTGAACAAACAGAGCAATGATGG + Exonic
1041655159 8:60342091-60342113 CTGAATAAACTAAGTATTGAAGG + Intergenic
1041733918 8:61090050-61090072 AAGAATAATCAAAGAAAGGAGGG - Intronic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1041930902 8:63285209-63285231 CTACAAAAACAAAGGAAGGAGGG - Intergenic
1042110578 8:65377289-65377311 CAAAAGAAACAATGGAAGGAAGG - Intergenic
1042198446 8:66254986-66255008 CTGCTGAAACAAAGAAAGGAGGG - Intergenic
1042397681 8:68310997-68311019 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1042502700 8:69526788-69526810 GTCAAGAAAGAAAGGAAGGAAGG + Intronic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1042823486 8:72957037-72957059 CTAAAAAAGGAAAGGAAGGAAGG + Intergenic
1043115431 8:76247360-76247382 TTGAATAAAAAAAGAAAGGCAGG - Intergenic
1043450501 8:80361428-80361450 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1043530287 8:81142566-81142588 CTGAAGGAAGGAAGGAAGGAAGG - Intergenic
1043663855 8:82783087-82783109 AGGAAGAAACAAAGGAAAGAAGG + Intergenic
1043998381 8:86847427-86847449 CATAAGAAAGAAAGGAAGGAAGG + Intergenic
1044089001 8:87975822-87975844 CTGAATGAACAAGTGAATGAAGG + Intergenic
1044091685 8:88010331-88010353 GAGAATAAAAGAAGGAAGGATGG - Intergenic
1044128054 8:88483090-88483112 CTGAATAAACTAAGTATTGAAGG + Intergenic
1044251029 8:90004034-90004056 ATGAATCAAAAAAGGAAGAATGG - Intronic
1044400698 8:91768415-91768437 CAAAAGAAAAAAAGGAAGGAAGG - Intergenic
1044512128 8:93094396-93094418 TGGAAGAAAGAAAGGAAGGATGG + Intergenic
1044645605 8:94439927-94439949 CTGGATCTAGAAAGGAAGGAAGG + Intronic
1045141440 8:99289057-99289079 ATGAATGAAAGAAGGAAGGAAGG + Intronic
1045221070 8:100201114-100201136 CTAAAAAAAGGAAGGAAGGAAGG - Intronic
1045221071 8:100201118-100201140 TTGTCTAAAAAAAGGAAGGAAGG - Intronic
1045497995 8:102724592-102724614 CAAAAAAAAAAAAGGAAGGAAGG - Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1046485916 8:114888365-114888387 AAGAAGAAACAAAGGAAGGAAGG - Intergenic
1046558444 8:115806794-115806816 AAGAAAAAAAAAAGGAAGGAAGG + Intronic
1046577670 8:116051326-116051348 GGGAATGCACAAAGGAAGGAGGG - Intergenic
1046734294 8:117759908-117759930 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1046922564 8:119748121-119748143 CTCAAAAAATAAAGAAAGGAAGG + Intronic
1046922565 8:119748125-119748147 AAAAATAAAGAAAGGAAGGAAGG + Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1047055157 8:121155730-121155752 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1047371663 8:124261054-124261076 GTCAAGAAAGAAAGGAAGGAAGG + Intergenic
1047549073 8:125850115-125850137 CGGAAGAAAGGAAGGAAGGAAGG - Intergenic
1047598810 8:126406063-126406085 CGGAAGGAAGAAAGGAAGGAAGG - Intergenic
1047714950 8:127586906-127586928 CTTAATAAACAATGAAAGGATGG + Intergenic
1047784755 8:128142884-128142906 GGAAAGAAACAAAGGAAGGAAGG - Intergenic
1047784761 8:128142921-128142943 GGAAAGAAACAAAGGAAGGAAGG - Intergenic
1047857688 8:128930204-128930226 CTAAATAAATAAAGGATGAAAGG - Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1048003180 8:130396444-130396466 TTAAATACATAAAGGAAGGAAGG - Intronic
1048053871 8:130845830-130845852 TTGAATTAATAAAAGAAGGAAGG + Intronic
1048053872 8:130845834-130845856 ATTAATAAAAGAAGGAAGGAAGG + Intronic
1048054095 8:130846945-130846967 ATTAAGGAACAAAGGAAGGAAGG - Intronic
1048382976 8:133884396-133884418 AGGAAGAAATAAAGGAAGGAAGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1048993931 8:139777509-139777531 CTGAATGAGCAAATGAATGAAGG + Intronic
1049889336 9:53870-53892 CTGAAGGAAGGAAGGAAGGAAGG + Intergenic
1050725377 9:8643376-8643398 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
1051154998 9:14132874-14132896 ATGAAGAAAAAAAGGAAGAAAGG - Intronic
1051189737 9:14498842-14498864 CTAAGAAAGCAAAGGAAGGAAGG - Intergenic
1051699551 9:19806871-19806893 CTGAATCTGCAAAGAAAGGAGGG - Intergenic
1052029371 9:23610968-23610990 TTGAAGAATGAAAGGAAGGAAGG + Intergenic
1052064119 9:23995663-23995685 CTCAATAAACTAAGGATTGATGG + Intergenic
1052211299 9:25906858-25906880 AAGAAAAAAGAAAGGAAGGAGGG + Intergenic
1052231039 9:26153329-26153351 ATGAAGAAAGGAAGGAAGGAAGG + Intergenic
1052635307 9:31095507-31095529 AGAAATAAAAAAAGGAAGGAAGG + Intergenic
1052652039 9:31317124-31317146 AGGAAAAAACGAAGGAAGGAAGG + Intergenic
1053540630 9:38970117-38970139 ATCAAGAAAGAAAGGAAGGAGGG - Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053730826 9:41055155-41055177 CTGAAGGAAGAAAGGAAGGAAGG + Intergenic
1053804964 9:41792246-41792268 ATCAAGAAAGAAAGGAAGGAAGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054140296 9:61523121-61523143 ATCAAGAAAGAAAGGAAGGAAGG + Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1054625509 9:67393789-67393811 ATCAAGAAAGAAAGGAAGGAGGG + Intergenic
1054727348 9:68665733-68665755 TTGAAGAAACAAATGAATGATGG - Intergenic
1054863391 9:69975600-69975622 CTGAAAATCCAAAGGAAGGCCGG + Intergenic
1054989223 9:71302780-71302802 CTAAAAAAAAAAAGGAAGGAAGG + Intronic
1055133481 9:72802587-72802609 CTGAGTAAATAATGGAATGAAGG + Intronic
1055204729 9:73714276-73714298 CTGAATAAATAAACAAAGGAAGG - Intergenic
1055344070 9:75315439-75315461 CTATAGAAAGAAAGGAAGGAAGG - Intergenic
1055618074 9:78093878-78093900 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1055819452 9:80244407-80244429 CTGTATAAAGAGAGTAAGGATGG + Intergenic
1055926294 9:81513674-81513696 GTGTATAAAATAAGGAAGGAAGG + Intergenic
1056058447 9:82855052-82855074 ATGATTAAACATAGTAAGGAAGG - Intergenic
1056096086 9:83255349-83255371 CTCAATAAACTAAGTAATGAAGG + Intronic
1056120169 9:83479618-83479640 CTGAAGAAAGGAAGGAAGGAAGG + Intronic
1056194460 9:84215758-84215780 CTGAAGAAACAAACAAAGCAGGG - Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056378222 9:86034965-86034987 ATGAATGAAGGAAGGAAGGAAGG - Intronic
1056378223 9:86034969-86034991 GTGAATGAATGAAGGAAGGAAGG - Intronic
1056566159 9:87774524-87774546 CTCAAAAAAGAAAGAAAGGAAGG - Intergenic
1056859084 9:90163153-90163175 GAAAATAAACATAGGAAGGAAGG + Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057743234 9:97730604-97730626 CAGTAAAAAGAAAGGAAGGATGG - Intergenic
1058136806 9:101316560-101316582 ATGAAGAAACAAAGAAAGTATGG + Intronic
1058139191 9:101340131-101340153 AGGAAAAAAGAAAGGAAGGAAGG - Intergenic
1058157057 9:101527839-101527861 CTGTATACACACAGCAAGGAGGG - Intronic
1058249222 9:102669960-102669982 CTAAATAAAGAAAGGAAGAGAGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058601778 9:106678311-106678333 ATGACTAAATAAAGGAAAGAAGG - Intergenic
1058642796 9:107103483-107103505 CTGAATAGCTAAAGGAAGTAAGG + Intergenic
1058816307 9:108685710-108685732 CTGAAGAGAAAAGGGAAGGAAGG + Intergenic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059103067 9:111488065-111488087 CTCAAAAAAGAAAGGAAGGAAGG + Intergenic
1059352936 9:113678423-113678445 AAGAAAAAAGAAAGGAAGGAAGG - Intergenic
1059860238 9:118452304-118452326 ATAAAAAAAGAAAGGAAGGAAGG + Intergenic
1059931083 9:119261806-119261828 AAGAATAAACGAAGGAAGAAAGG - Intronic
1059970784 9:119666111-119666133 TTAAAGAAACAAAGGAAGAAAGG - Intergenic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1060592737 9:124829158-124829180 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1060814456 9:126627276-126627298 CTGAGTAAAAAAGGGAAGAAGGG - Intronic
1061313566 9:129779636-129779658 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1061617705 9:131791252-131791274 CTGAATACACGAAGCCAGGAGGG + Intergenic
1061696129 9:132374936-132374958 CTGTAAAAAGGAAGGAAGGAAGG - Intergenic
1061746343 9:132743002-132743024 CTGAAGGAACAAGGGGAGGAGGG + Intronic
1061868662 9:133508355-133508377 ATGAAGAAAGTAAGGAAGGAAGG - Intergenic
1062016308 9:134292964-134292986 ATGAATGAACGAAGGAAGGAAGG + Intergenic
1185431185 X:13006-13028 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185431987 X:16686-16708 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185440452 X:225403-225425 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185516980 X:707482-707504 CTCAAGAAAGAAAGGAACGAGGG - Intergenic
1185522239 X:749508-749530 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1185545020 X:936550-936572 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185653116 X:1663193-1663215 AGGAAGGAACAAAGGAAGGAAGG - Intergenic
1185799459 X:2996600-2996622 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1185822479 X:3218851-3218873 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185850720 X:3483888-3483910 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1185850727 X:3483969-3483991 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1186019129 X:5234812-5234834 AAGAACAAAGAAAGGAAGGAAGG - Intergenic
1186039911 X:5464329-5464351 ATGAAGAAAGGAAGGAAGGAAGG + Intergenic
1186145651 X:6621680-6621702 GTGAAGAAAAGAAGGAAGGAGGG + Intergenic
1186166066 X:6827284-6827306 ATGCAAAAACAAAGCAAGGAAGG + Intergenic
1186328233 X:8503036-8503058 CTGAATCTACAAATAAAGGAAGG + Intergenic
1186930471 X:14383560-14383582 CTCAATAAAAAAAGAAATGATGG - Intergenic
1186955859 X:14681360-14681382 TTGAATGAAAGAAGGAAGGAAGG - Intronic
1187206889 X:17190452-17190474 CTGAAGAAATAAACCAAGGAAGG + Intergenic
1187264399 X:17718306-17718328 CTGAAAAAATAAAGATAGGAAGG + Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187825209 X:23328704-23328726 CTGAATAAACACAGGACTCAGGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188173472 X:26958356-26958378 GTGAAAAAAAAAAGGAGGGAGGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188418724 X:29971064-29971086 GTGAATGAAGTAAGGAAGGAAGG - Intergenic
1188680825 X:33002282-33002304 ATGCACAAACAAAGCAAGGAAGG + Intronic
1188717611 X:33479338-33479360 TTGAGTAAACAAAGGAATTAAGG + Intergenic
1189249485 X:39589000-39589022 CTGATTATACACAGCAAGGAGGG + Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189301304 X:39954514-39954536 ATGAACAAATGAAGGAAGGAAGG + Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189671205 X:43411263-43411285 GGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1189825843 X:44916389-44916411 GGGAAGAAAGAAAGGAAGGAAGG + Intronic
1189867292 X:45344238-45344260 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1190211356 X:48451073-48451095 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1190408244 X:50109190-50109212 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1190429931 X:50369482-50369504 AAGAATAAAGAAAGGACGGAAGG - Intronic
1190872291 X:54434330-54434352 ATTAAAAAAAAAAGGAAGGAAGG - Intergenic
1191054780 X:56230905-56230927 CTGAAGAAATTAAGTAAGGAGGG + Intergenic
1191646835 X:63490879-63490901 CTAAAGAAAGACAGGAAGGAAGG + Intergenic
1192033479 X:67539873-67539895 CAGAATATGCAAAGGCAGGAAGG + Intergenic
1192421320 X:71034104-71034126 CAAAAAAAAAAAAGGAAGGAAGG + Intergenic
1192540105 X:71961453-71961475 AGGAATAAAGAAAGGAAGGGAGG - Intergenic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192606818 X:72527214-72527236 CTGAACATGCAAAGGTAGGAAGG - Intronic
1192680158 X:73244303-73244325 TTTAATAAAGAAAGAAAGGAAGG + Intergenic
1192754094 X:74027843-74027865 GAGAATAAAAAAATGAAGGAAGG + Intergenic
1193226229 X:78987199-78987221 ATGAAGGAAGAAAGGAAGGAAGG - Intergenic
1193273609 X:79557855-79557877 AGGAAAAAAGAAAGGAAGGAAGG + Intergenic
1193507775 X:82364160-82364182 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1193761716 X:85475308-85475330 TAGAATAGACAAAGGAAGTATGG + Intergenic
1193784198 X:85739127-85739149 TTGAATAAACAAAGGAGAGAAGG + Intergenic
1193793354 X:85843189-85843211 AGGAAGAAACGAAGGAAGGAAGG + Intergenic
1193915669 X:87359796-87359818 ATGAATGAAAAAATGAAGGAAGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194440361 X:93925389-93925411 CAGAAGAAAGGAAGGAAGGATGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194754840 X:97726604-97726626 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1194980200 X:100432715-100432737 CTGAATAAAGATGGGAATGAGGG - Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195020613 X:100823411-100823433 CTGATGAAACAAATGAAGGTGGG + Exonic
1195373486 X:104202647-104202669 CTGAATAAATAAATAAAGGCTGG - Intergenic
1195485155 X:105396315-105396337 TTTATTAAAAAAAGGAAGGAGGG - Intronic
1196159734 X:112469687-112469709 CTTAATAAACAAATGTAAGATGG + Intergenic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196349522 X:114709730-114709752 AGGAATAAGAAAAGGAAGGAAGG - Intronic
1196587577 X:117447391-117447413 CTCAATAAACTAGGGATGGATGG + Intergenic
1197397629 X:125946484-125946506 AAGAAGAAACAAAGGAAAGAAGG + Intergenic
1197464703 X:126788808-126788830 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198006905 X:132504064-132504086 ATGAATAAATGAAGGAAGGAAGG + Intergenic
1198258955 X:134949383-134949405 ATAAATAAACAAAGGAGGCAGGG + Intergenic
1198518734 X:137431690-137431712 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1198518764 X:137431911-137431933 AGGAATAAAAAAAGGAAGGGAGG + Intergenic
1198518789 X:137432123-137432145 AGAAATAAAGAAAGGAAGGAAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198686931 X:139237129-139237151 TTGAATGAAAACAGGAAGGAAGG - Intergenic
1198756032 X:139983509-139983531 CGAAAAAAAGAAAGGAAGGAAGG - Intergenic
1198855204 X:141008292-141008314 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1198876810 X:141236849-141236871 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1198907487 X:141579077-141579099 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1198909303 X:141595345-141595367 AGGAAGAAAGAAAGGAAGGAAGG + Intronic
1198917780 X:141692805-141692827 AGGAAGAAAGAAAGGAAGGAAGG - Intronic
1199342514 X:146698146-146698168 TTGAAGAAAGGAAGGAAGGATGG + Intergenic
1199342526 X:146698270-146698292 TTGAAGAAAGGAAGGAAGGAAGG + Intergenic
1199464031 X:148116063-148116085 CTGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199485479 X:148342718-148342740 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199696302 X:150345000-150345022 CTGAAAGAAGGAAGGAAGGAAGG + Intergenic
1199723033 X:150556810-150556832 ATGAATAAACAAAAGATGGTAGG + Intergenic
1199804637 X:151286005-151286027 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1200015379 X:153158428-153158450 AAGAAAAAAGAAAGGAAGGAAGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200734088 Y:6775203-6775225 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1200762639 Y:7054182-7054204 ATGCACAAACAAAGCAAGGAAGG + Intronic
1200820522 Y:7577957-7577979 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1201230865 Y:11862991-11863013 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1201235346 Y:11904958-11904980 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201484396 Y:14476569-14476591 CTGAATAAACTAAGTATTGATGG - Intergenic
1201550559 Y:15212695-15212717 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1201625764 Y:16012537-16012559 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1201625767 Y:16012557-16012579 AGGAAGAAAAAAAGGAAGGAAGG + Intergenic
1201706183 Y:16939687-16939709 AGGAAAAAAGAAAGGAAGGATGG - Intergenic
1201733715 Y:17234530-17234552 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1202196286 Y:22301102-22301124 CAGAAGAAAAGAAGGAAGGATGG + Intergenic
1202330014 Y:23739502-23739524 CAAAATAAAAAAAGAAAGGAAGG + Intergenic
1202330015 Y:23739506-23739528 ATAAAAAAAGAAAGGAAGGAAGG + Intergenic
1202333901 Y:23785399-23785421 AGGAAGAAAGAAAGGAAGGAAGG + Intergenic
1202536868 Y:25884664-25884686 AGGAAGAAAGAAAGGAAGGAAGG - Intergenic
1202540755 Y:25930548-25930570 ATAAAAAAAGAAAGGAAGGAAGG - Intergenic
1202540756 Y:25930552-25930574 CAAAATAAAAAAAGAAAGGAAGG - Intergenic