ID: 1129360114

View in Genome Browser
Species Human (GRCh38)
Location 15:75019329-75019351
Sequence CAGAGGGGCCAGAGGCAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 7, 3: 62, 4: 582}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129360114_1129360119 -9 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360119 15:75019343-75019365 GCCCCTCTGACCCTGGCCCAGGG 0: 1
1: 2
2: 3
3: 58
4: 947
1129360114_1129360127 4 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360127 15:75019356-75019378 TGGCCCAGGGACCCCTCACGGGG 0: 1
1: 1
2: 2
3: 20
4: 171
1129360114_1129360133 14 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360133 15:75019366-75019388 ACCCCTCACGGGGCCAGGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 224
1129360114_1129360132 11 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360132 15:75019363-75019385 GGGACCCCTCACGGGGCCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 151
1129360114_1129360126 3 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360126 15:75019355-75019377 CTGGCCCAGGGACCCCTCACGGG 0: 1
1: 0
2: 4
3: 36
4: 306
1129360114_1129360118 -10 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360118 15:75019342-75019364 GGCCCCTCTGACCCTGGCCCAGG 0: 1
1: 1
2: 6
3: 77
4: 731
1129360114_1129360131 10 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360131 15:75019362-75019384 AGGGACCCCTCACGGGGCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 191
1129360114_1129360130 9 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360130 15:75019361-75019383 CAGGGACCCCTCACGGGGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 299
1129360114_1129360125 2 Left 1129360114 15:75019329-75019351 CCCTCTTGCCTCTGGCCCCTCTG 0: 1
1: 0
2: 7
3: 62
4: 582
Right 1129360125 15:75019354-75019376 CCTGGCCCAGGGACCCCTCACGG 0: 1
1: 0
2: 2
3: 41
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129360114 Original CRISPR CAGAGGGGCCAGAGGCAAGA GGG (reversed) Exonic
900080940 1:856922-856944 GAGAGGGGCTTGAGGCAGGAAGG - Intergenic
900387333 1:2416619-2416641 CAGAGGCCCCAGAGCCAAGATGG + Intergenic
900721035 1:4175982-4176004 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
900721046 1:4176025-4176047 CAGAGGGGTCGGAGGTCAGAGGG - Intergenic
901196975 1:7445625-7445647 CGGAGGAGCCAGAGAGAAGAGGG + Intronic
901265834 1:7910133-7910155 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
901928860 1:12584057-12584079 CATAGGAGCCAGAGGTAGGATGG - Intronic
902052658 1:13576671-13576693 GAGATGGGCGAGAGGCATGAAGG - Intergenic
902190960 1:14762782-14762804 CACAGGGGCCATGGGCCAGACGG + Intronic
902786703 1:18737229-18737251 CAGAAGGGCGTGTGGCAAGAGGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903777964 1:25805345-25805367 CACAGAGGGCAGAGGAAAGATGG - Intronic
904036528 1:27561999-27562021 CAGAGGGGAGAGAGGCACGGGGG + Intronic
904045804 1:27607490-27607512 AGGAGAGGCCAGAGGCCAGAGGG + Intergenic
904510950 1:31007281-31007303 CAGAGAGGCCTAAGGCAAGGTGG + Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905249534 1:36639002-36639024 AAGAGGAGCCAGAAGCAAGCTGG - Intergenic
905688629 1:39926755-39926777 ACGAAGGCCCAGAGGCAAGAAGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906150331 1:43583809-43583831 CAGAGGGGCCTGGGGCAGGTAGG - Intronic
906531999 1:46529122-46529144 CAGAGTGGCGAGGGGCAAGAGGG - Intergenic
909501178 1:76337301-76337323 CTGCTGGCCCAGAGGCAAGAGGG + Intronic
911183691 1:94883051-94883073 CAGAGAGGCCAGGGGTCAGAAGG + Intronic
912468059 1:109887502-109887524 CAGAGTGGCCAGAGACAAGAGGG - Intergenic
913077132 1:115350186-115350208 CAGAGTGGTGAGAGGCAACAAGG - Intergenic
913699728 1:121362641-121362663 GAGATGGCCCAGAGGCAGGAGGG + Intronic
914804457 1:150982356-150982378 CAGAGGTGCCAGAGGTGAGGTGG - Exonic
914877183 1:151520704-151520726 TAGAGGTGCCGGAGGCATGAAGG + Intronic
915517159 1:156420309-156420331 CAGAGGGGCCCGGGGAAAGCCGG - Intronic
915589718 1:156863625-156863647 AAGAGGGGCCAGAGGCTATGGGG + Intronic
915671413 1:157491893-157491915 CAGAAGGTCCAGGGGAAAGAAGG - Intergenic
916426435 1:164685579-164685601 AAGAGGGTCCAGAGACAAAAGGG + Intronic
916604855 1:166330979-166331001 CAGAAAGGCCAGAGGAATGAAGG + Intergenic
916687725 1:167162306-167162328 GAGTGGGGCCTGAGGCAAGAGGG - Intergenic
916713684 1:167433034-167433056 CGGAGGGGCAAGGGGCACGATGG - Exonic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
918259549 1:182783209-182783231 CTGAGGGGGCTGAGGCAGGAGGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
919239147 1:194889404-194889426 CAGAGGGGACTGAGGCAGTAGGG - Intergenic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920260180 1:204683915-204683937 CACAGGGCCCAAAGGCAAGGGGG + Intronic
920784248 1:209025633-209025655 AAGAGCTGCCAGTGGCAAGATGG + Intergenic
920872416 1:209805595-209805617 CACAGGGGCCAGCCGCAAGTTGG + Intronic
920970004 1:210735025-210735047 CAGTGGGGCCCAAGGCATGACGG - Intronic
921098595 1:211909163-211909185 CAGAGGGCCCAGAGCAAAGGTGG + Intergenic
921570177 1:216768595-216768617 CTGAGGAGGCTGAGGCAAGAGGG - Intronic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922141746 1:222894417-222894439 CAGAGGGGACTGAGGCAGCAGGG + Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
923137532 1:231131497-231131519 CAGAGGGTGCAGAGGTAATAAGG - Intergenic
923247558 1:232147351-232147373 AAGAAGGGCGAGAGGAAAGAAGG + Intergenic
923800663 1:237205561-237205583 CAGAAAGGTCAGAGGCAGGATGG + Intronic
923990227 1:239427708-239427730 CAGAGGAGACTGAGACAAGATGG + Intronic
924948756 1:248863767-248863789 CAGAGGGGGCCGAGGCAGCAGGG - Intergenic
1062857079 10:784762-784784 CAGAGGGGCCAGCGGGGAGCCGG - Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064259666 10:13775134-13775156 AAGAGAGGACACAGGCAAGAGGG + Intronic
1064579284 10:16777802-16777824 CACAGAGGCCAGGGGCAGGAAGG + Intronic
1065077866 10:22098825-22098847 CAGAGGGGTCAGGAGCAAGATGG + Intergenic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1065785208 10:29206635-29206657 CAGAGGGTACACAGGTAAGAGGG + Intergenic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066205795 10:33188168-33188190 TTGAGGGGACAGAGGCACGATGG - Intronic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1067451531 10:46384874-46384896 CAGAGGAGCCGGAGTCCAGATGG - Intronic
1067557928 10:47285362-47285384 AAGGGAGGCCAGAGGAAAGAAGG + Intergenic
1067585708 10:47474882-47474904 CAGAGGAGCCGGAGTCCAGATGG + Intronic
1069628009 10:69880296-69880318 CAGAGGGCACAGGGGCAAGGAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1069878580 10:71578010-71578032 CAGAGGGGTGAGAGGAGAGAGGG - Intronic
1070455249 10:76608509-76608531 AAGAGGGGGCAGATCCAAGATGG + Intergenic
1071397433 10:85237842-85237864 GAGAATGGGCAGAGGCAAGATGG + Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071919095 10:90329292-90329314 CAGATGGGTGAGAGGCAACATGG + Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1072957070 10:99896588-99896610 GAGAGGGGCCAGAGACAAGGAGG + Intronic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074232168 10:111548551-111548573 CAGAGAGGCCAGAGAGAAAAGGG - Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074507914 10:114087579-114087601 CAGAGGGGCCAGAGACAGAAGGG + Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076729015 10:132429181-132429203 CCGAGGGGCCAGTGGCAGCAGGG + Intergenic
1077084016 11:738718-738740 AAGAGGAGCCAGAGACAGGAGGG + Intergenic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078720501 11:13879624-13879646 CAGAGGTGCCAAAGGAGAGAGGG - Intergenic
1078748645 11:14139220-14139242 GAGAAGGTCCAGAGACAAGAAGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079134028 11:17765981-17766003 CGGAGGAGGCAGAGGCAAGGTGG + Intronic
1079184178 11:18221417-18221439 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080895523 11:36446276-36446298 TAGAGGGGACAGAGGAGAGAGGG - Intronic
1081632924 11:44701645-44701667 CAGAAGGGGCTGAGGCCAGAGGG + Intergenic
1083166669 11:60892710-60892732 AAGAGGGGCAAGAGACAGGAGGG - Intronic
1083193529 11:61069296-61069318 CTGAGGGGCCAGAAGAAAGGGGG - Intergenic
1083365347 11:62138757-62138779 CAGCTGAGCCAGAGGTAAGACGG + Exonic
1083447625 11:62719842-62719864 CAGGAGGGCAAAAGGCAAGAGGG - Intronic
1083463313 11:62829654-62829676 CTGAGGAGCCTGAGGCAGGAGGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085284268 11:75349949-75349971 AAAAGGGGCCAGAGGCAGGGCGG - Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1086850076 11:91798716-91798738 CAGAGGGGGCAGAGGCAGTGGGG - Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1088020242 11:105110657-105110679 TAGAGGGGCCACAGGAAACAAGG - Intergenic
1089253170 11:117179461-117179483 CTTAGGGGCCAGAGGCGAGTGGG + Intronic
1089461556 11:118657141-118657163 CAAAGGGGTCTGAGGCAGGAGGG - Exonic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1089895552 11:121927004-121927026 AAGAGGGGCAAGAGACAGGAGGG + Intergenic
1090076241 11:123581588-123581610 CTGAGGGGCCACAGGAAAAATGG - Intronic
1090471582 11:126985598-126985620 CAGAGGGACAGGAGGCACGAGGG + Intronic
1091303476 11:134522892-134522914 GAGCTGGGCCAGAGGCGAGAGGG - Intergenic
1091369185 11:135044491-135044513 CAGATGGGCCTGTGGCAAGCAGG + Intergenic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092225271 12:6744371-6744393 CAGAGGGGCCTGAGCCCAGGTGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095722576 12:45416732-45416754 CAGAGGGGCCAGTGGAAAAGAGG - Exonic
1096257517 12:50072423-50072445 CAGAGGGGCCAGGGGCCTGGGGG + Intronic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1096747835 12:53739912-53739934 CAAACGGGCGAGAGGCATGATGG + Intergenic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1097957507 12:65501238-65501260 CAGAGGAGCCAGAGCCAAGGTGG - Intergenic
1099252442 12:80272811-80272833 CATAGGAGGCAGAGACAAGAAGG + Intronic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1100355684 12:93827009-93827031 AAGTGGGGCCAGGGACAAGAAGG + Intronic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1102650694 12:114440128-114440150 CAGCGGGGACAAAGGCCAGAGGG - Intergenic
1103134417 12:118495260-118495282 GGGAAAGGCCAGAGGCAAGAAGG - Intergenic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1105041808 12:132966937-132966959 CAGAGGGGGCTGAGGCAGCAAGG - Intergenic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1108017070 13:46086832-46086854 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1108542486 13:51456717-51456739 CAGAGGGGACTGAGGCAGCATGG + Intergenic
1109762266 13:66845296-66845318 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1112260574 13:97874367-97874389 CTCAGGGGTTAGAGGCAAGATGG + Intergenic
1112477705 13:99747380-99747402 CAGAGCGGCAGGAGGCAAGGAGG - Intronic
1112707287 13:102085105-102085127 CAAAGGGGGCAGAGGAAAGGTGG - Intronic
1113166583 13:107450079-107450101 CAGAGGGGACAGATGATAGAAGG - Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115141643 14:30178185-30178207 TGCTGGGGCCAGAGGCAAGAGGG - Intronic
1115350143 14:32385125-32385147 CAGAGTGTCATGAGGCAAGATGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116484233 14:45427660-45427682 AAGAGGGACCTGGGGCAAGAAGG + Intergenic
1116711412 14:48372386-48372408 GAGAGGGGGAAGAGCCAAGATGG - Intergenic
1116902199 14:50371968-50371990 CAGAGGGGTCCGAGGCAGCAGGG - Intronic
1117125321 14:52617057-52617079 CATAGCAGCCAGAGGAAAGAAGG - Intronic
1117620136 14:57577097-57577119 AAGAGGAGCCAAAGGCAAGATGG + Intronic
1118239725 14:64044541-64044563 TGGAGGGGCCAGATGCAAAATGG + Intronic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1118867010 14:69711918-69711940 CACAGGGGCCTGGGGCAGGAAGG + Exonic
1119227507 14:72955509-72955531 CAGAGGAGCCTGTGGAAAGAGGG - Exonic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1119949849 14:78733530-78733552 CAGAGTGGTCAGAGGTAACAAGG + Intronic
1120367610 14:83590966-83590988 ATGAGGGGCCAGAGACAGGAGGG - Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121509349 14:94500792-94500814 CTGGGGGTCCAGAGGCAAGGTGG - Intronic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1122782509 14:104149643-104149665 CAGAGGGGCAACAGGGAAAAGGG - Intronic
1124177013 15:27435879-27435901 TAGAGCAGCCAGAGGCAAGTTGG - Intronic
1125523273 15:40359692-40359714 GAGAGGGGCCAGAGGCCCCAGGG - Intronic
1125722313 15:41851209-41851231 CAGAGGGGCCCCAGGACAGAGGG - Intronic
1125769918 15:42158291-42158313 CAGATGGGACAGAGACAACAAGG + Intergenic
1125862015 15:43008425-43008447 CAGAGGGGTCCAAGGCAGGAGGG - Intronic
1126878770 15:53072195-53072217 GAGAGTGGCCAGTGGCAAGAAGG + Intergenic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1127810671 15:62562485-62562507 TAGAAGGGGCAGAGCCAAGAGGG - Intronic
1128346912 15:66859838-66859860 GAGAGGGGTCAGAGGCAGAAAGG - Intergenic
1128506168 15:68274378-68274400 CAGAGGAGGCAGAGGCCAGTGGG + Intergenic
1128650933 15:69413162-69413184 CAGAGGGGTGGGAGACAAGAGGG + Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1131050227 15:89342918-89342940 TCTAGGGGCCACAGGCAAGAGGG + Intergenic
1131283329 15:91038482-91038504 CAGCGGGGTCAGAGGCCACAGGG + Intergenic
1131509943 15:93044382-93044404 CAGGGAGGCCACAGGCCAGAAGG + Intronic
1131568363 15:93506614-93506636 CAGAGGGGACTGAGGCAGCAGGG + Intergenic
1131843054 15:96458535-96458557 CAGAGTGCCATGAGGCAAGAGGG - Intergenic
1132410845 15:101577248-101577270 AAAAGGGGCAAGAGGAAAGAGGG + Intergenic
1132756668 16:1488520-1488542 AGGTGGGGCCAGAGGCTAGAAGG - Intronic
1133028399 16:2998439-2998461 CACTGGGGGCAGAGGCTAGAAGG - Intergenic
1134072361 16:11268747-11268769 CAAAGGAACCACAGGCAAGAAGG - Intronic
1134078471 16:11308695-11308717 CAGAGGGGGCTGAGGCAGCAGGG + Intronic
1134215895 16:12316733-12316755 CAGAGAAGCCAGGGGCAGGAAGG - Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134805378 16:17119756-17119778 CAGAGGGGGCAGAGCCAGCATGG + Intronic
1135170873 16:20182240-20182262 CAGAGGAGCCAAAGAAAAGAAGG + Intergenic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1135768088 16:25195202-25195224 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137270906 16:46901757-46901779 CAGGGGGGCCACAGCCAGGAGGG - Intronic
1137343834 16:47636652-47636674 CAGAGGGGGCTGAGGCAGCAGGG - Intronic
1137672970 16:50290287-50290309 CAGAGGTGACAAAGGCCAGAAGG + Intronic
1138195919 16:55052007-55052029 AAGAGGGGGCTGAGACAAGATGG - Intergenic
1138680051 16:58677794-58677816 AAGAGATGCCAGAGGTAAGAGGG + Intronic
1138947763 16:61872874-61872896 CAGAAGGCACAGAAGCAAGAAGG + Intronic
1140028144 16:71310778-71310800 CAGAGTGGGCAGAGACTAGAAGG + Intergenic
1140758873 16:78093094-78093116 CTAGGGAGCCAGAGGCAAGAAGG - Intergenic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1141771025 16:86089719-86089741 CGCAGGGGCCAGAGGCCCGAGGG + Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142031937 16:87842876-87842898 CAGATGGGAGAGAGGCCAGAGGG - Intronic
1142434172 16:90046721-90046743 CACAGGGGCCTGAGGCTGGAGGG + Intergenic
1142514124 17:415928-415950 CGGAGGTGGCAGAGCCAAGATGG + Intronic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143583467 17:7839457-7839479 AAGAGGGGGCAGAGTCCAGAGGG + Intergenic
1143782035 17:9234031-9234053 CATGGGGGCCAGAGTCAACAAGG - Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144389923 17:14784174-14784196 CAGAGGGGGCCGAGGCAGCAGGG - Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144574288 17:16419191-16419213 CAGAAGCCCCAGAGGCAAGTTGG + Intronic
1144580079 17:16453787-16453809 AAGAAGGGCCAGAGACAGGAGGG - Intronic
1144786013 17:17831997-17832019 CAGAGGGGTCAGAGGCTATGTGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145209077 17:20999965-20999987 CAGAGGGCCCCGGGGCCAGAGGG + Exonic
1145246340 17:21272310-21272332 GAGAGCAGCCAGAGGCAAGCAGG + Intergenic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146797752 17:35795004-35795026 CAGACGGGCAAGAGCCCAGAGGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147252912 17:39164440-39164462 ACTAGGAGCCAGAGGCAAGAAGG + Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147844090 17:43392844-43392866 CAGAGGTGACAGTGCCAAGAAGG - Intergenic
1147934136 17:44001815-44001837 CAAAGAGGACAGAGACAAGAAGG + Intronic
1148539914 17:48472179-48472201 CAGAGGAGCTAGAGGCCAGTGGG + Intergenic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1148794840 17:50191988-50192010 CAGAGGGGCCAGGGGCGCCAAGG + Exonic
1148867619 17:50637004-50637026 CAGAGGGCCCAGAGGCTCAAAGG - Intronic
1148912844 17:50952297-50952319 CACAGGGGTCAGAGGAAGGAGGG + Intergenic
1150201586 17:63362615-63362637 CAGAGGGGACTGAGGCAGCATGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151741313 17:75984153-75984175 CTTAGAGGCCAAAGGCAAGAGGG + Intronic
1152862223 17:82703094-82703116 CAGCGGGGGCAGAGGCAACAAGG + Intergenic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157449717 18:47776277-47776299 CAGTTGGGACACAGGCAAGAAGG + Intergenic
1157506607 18:48230985-48231007 CAGAGGGGGCCGAGGCAGCAGGG - Intronic
1157573474 18:48729095-48729117 GAGAGGGGCCATGGGCAGGAAGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1157915806 18:51662684-51662706 CAGAGGGGCCAGAGTCACCGAGG + Intergenic
1159635890 18:70804639-70804661 CAGGTAGGCCAGAGGCAAGGGGG + Intergenic
1160225020 18:77005737-77005759 CAGAGGGGCCAGGGCCAGCAGGG + Intronic
1161065807 19:2236735-2236757 CAGAGGGTCCCGAGGCGCGAAGG - Exonic
1161781750 19:6297686-6297708 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162967602 19:14163441-14163463 GAGAAGGGGCAGAGGCGAGAGGG + Intronic
1163406478 19:17126188-17126210 CAGAGGGGGCGGAGGCCAGCAGG - Intronic
1163636539 19:18439523-18439545 GAAAGGGGCTAGAGGCAGGAGGG - Intergenic
1163755392 19:19103662-19103684 CCTAGGGCCCAGAAGCAAGATGG + Intronic
1164637078 19:29799432-29799454 CAGAGGGGCCACAGGTAAGGAGG + Intergenic
1165169288 19:33879934-33879956 CACAGGGGCCCGAGGCAACCCGG + Intergenic
1165798498 19:38533037-38533059 CAGAGGGGTCAGGGCCAAGATGG + Intronic
1165806575 19:38584411-38584433 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165806679 19:38584685-38584707 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165906954 19:39200066-39200088 CAGAGGGGTCAGGGCCAGGATGG - Intronic
1165999687 19:39870857-39870879 CAGAGGGGTCAGCGCCAGGATGG + Intronic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166194203 19:41195467-41195489 CAGAGTGGTCAGGGCCAAGATGG + Intronic
1166288969 19:41849638-41849660 GAGAGGGGCCAGAGGCCATTAGG + Intronic
1166888557 19:45975585-45975607 GAGATGGGGAAGAGGCAAGACGG + Intergenic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1167688754 19:50972502-50972524 GTGAAGGGCCAGAGGCCAGAGGG - Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
1168330424 19:55564550-55564572 CAGAGGGGCCCGAGGCTCCACGG - Intergenic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925274755 2:2640939-2640961 TAGAGGGGACAGAGGCAGGAGGG + Intergenic
925317693 2:2938365-2938387 GAGAGGGGCCTGGGGCAGGAGGG - Intergenic
925460031 2:4054042-4054064 GAGAGGATCCAGAGGCAAGGCGG - Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926089918 2:10043272-10043294 CAGCGGCGCCAGGGGCAAGCGGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927004283 2:18831927-18831949 CAGAGGGGGAAAATGCAAGATGG + Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
928219668 2:29393279-29393301 AAGAGGGGCGAGAGACAGGAGGG - Intronic
928588374 2:32786581-32786603 TGGAGGGACCAGAGGCAAGGAGG - Intronic
928797059 2:35034886-35034908 CAGAGGGGGCCAAGGCAGGAGGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929568634 2:43006210-43006232 CAGAGAGGCCAGAGGCAGAGGGG - Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930718750 2:54618554-54618576 CATAGGGGCAACAGGCAACAGGG + Intronic
931141090 2:59459047-59459069 AAGCGGGGACAAAGGCAAGAAGG - Intergenic
931224115 2:60314676-60314698 CAGAGAGACCCGAGGCAACATGG - Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932129967 2:69178540-69178562 GGGAGGGGCCAGCGGCAAGAGGG + Intronic
932129976 2:69178560-69178582 GGGAGGGGCCAGGGGCAAGAGGG + Intronic
932235037 2:70114175-70114197 CAGAAGGGCCAGGGGCATGGTGG - Intergenic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933092220 2:78135624-78135646 CAGAGGTGACATAAGCAAGATGG - Intergenic
933093231 2:78146500-78146522 CGGAGGGGCCTGAGGCCACAGGG - Intergenic
933294471 2:80473256-80473278 CAGAGGAGCCAAAGGCTACAGGG + Intronic
933571859 2:84023278-84023300 CAGTGAGGCCAGGTGCAAGAAGG + Intergenic
933839483 2:86275083-86275105 CGCAGGGCCCAGATGCAAGAGGG - Intronic
934660872 2:96143058-96143080 CAGAGGGGCCAGCGGCCGGAAGG - Intergenic
934696591 2:96404734-96404756 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
935123710 2:100203807-100203829 CTCAGAGGGCAGAGGCAAGACGG - Intergenic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
936050969 2:109223326-109223348 CAGAGCCGACAGAGCCAAGAGGG + Intronic
936846789 2:116844279-116844301 GAGAGGGGAGAGAGGAAAGAAGG - Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937069723 2:119053901-119053923 CAGAGGGGCCTGAGGAGAGGGGG - Intergenic
937248551 2:120509661-120509683 CAGAAGGGCCAGAAGATAGATGG + Intergenic
937536099 2:122889531-122889553 CAGAGGGGCGAGAGGGGAAATGG - Intergenic
937637905 2:124177275-124177297 ATGAGGGGCCAGAGACAGGAGGG + Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938903231 2:135816228-135816250 CAGAGAGGGAAGAGGCAAGGAGG - Intronic
940250436 2:151669687-151669709 CAGAAGGGCCACAGAGAAGAGGG + Intronic
940275757 2:151938939-151938961 CAGAGGTCCCAGAGCCAACACGG - Intronic
940378578 2:152987001-152987023 CAGAGCTCCCAGAGCCAAGAAGG - Intergenic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
941054843 2:160776311-160776333 CAGAGGGTTTAGAGCCAAGATGG + Intergenic
942132470 2:172893814-172893836 CAGAGATGCCTGAGGCAGGATGG - Intronic
942250819 2:174046427-174046449 CAGAAGGGCAAAAGGCAAAAGGG + Intergenic
942345784 2:175001507-175001529 CAGAAGGGTCTGAGGAAAGATGG + Intronic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944145494 2:196503351-196503373 CAGAGGGGCAAGATAGAAGAGGG + Intronic
944535507 2:200705688-200705710 AAGAGGGGGCAGAGGAGAGATGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945203775 2:207310509-207310531 CAGAGCAGCCAGAGCCAAGCAGG + Intergenic
945658847 2:212659469-212659491 GAGAGGGGCCAGAAGACAGAAGG + Intergenic
945770455 2:214035490-214035512 CAGAGGGGGCTGAGGCAACAGGG + Intronic
946410698 2:219513815-219513837 CAGAGGGGGCAGGGGCATGGTGG + Intergenic
946822497 2:223644789-223644811 CAGAGGTTGCAGAGCCAAGATGG - Intergenic
947232650 2:227903519-227903541 CAGAGGGGCAAGTGACCAGAGGG + Intronic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948002858 2:234582430-234582452 CAGAGGAGGCAAAGGAAAGAGGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948334723 2:237199004-237199026 CAGAGAGGACAGAGACAAGCTGG - Intergenic
948465338 2:238149332-238149354 CAGAGGGCCCACAGTGAAGAGGG + Intronic
948564966 2:238879127-238879149 CAGAGGGGACAGAGCCAGGAAGG - Intronic
948605909 2:239134529-239134551 CAGAGGGGCCGGTGGCAGGCAGG + Exonic
948641904 2:239380098-239380120 CATGGGTGCCAGAGCCAAGAGGG + Intronic
948791440 2:240379463-240379485 CAGAGGGACCAGACACACGAGGG - Intergenic
1169143253 20:3237826-3237848 CAGGCGGGCCAGAGGCGAGGAGG + Intronic
1169964601 20:11201783-11201805 CAGAAGGTCAAGAGGCAAAAAGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172184017 20:33020281-33020303 CAGAGGGCACAGAGCCATGAGGG - Intronic
1172346984 20:34209682-34209704 CAGAGGGGCCCAAGGCAGCAGGG - Intronic
1173580582 20:44143969-44143991 CAGAGGCTCGAGAGGCAAGGAGG + Intronic
1174553280 20:51376492-51376514 TAGAGGGGCAGGAGGCATGAGGG + Intergenic
1175247708 20:57591647-57591669 CAGAGGGGCCAGAGGGACATGGG + Intergenic
1175247955 20:57592669-57592691 CACAGGGGCCAGAGAAAGGAAGG + Intergenic
1175279700 20:57794831-57794853 GGGAGGGGACAGAGGCAGGATGG - Intergenic
1175418268 20:58815899-58815921 CAGAGGGGCGAGTGGCAGGTGGG + Intergenic
1175924729 20:62466119-62466141 CAGAGCTGCCAGGGGCCAGAAGG + Intronic
1176087580 20:63305064-63305086 CCGAGGGGCCAGGTCCAAGAAGG - Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176423816 21:6535531-6535553 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1178458837 21:32782244-32782266 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1178809184 21:35865788-35865810 CTGAGGGGCCAGGAGTAAGAGGG + Intronic
1178864555 21:36317128-36317150 CAGAGGGGGGAGTAGCAAGATGG - Intergenic
1179126399 21:38595036-38595058 CAGGAGAGCCCGAGGCAAGAGGG + Intronic
1179699309 21:43143846-43143868 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1179807267 21:43847632-43847654 GGGAGGGGACAGAGGCCAGATGG + Intergenic
1179884750 21:44309087-44309109 CAGAGGGTCGAGAGGCAGAAGGG + Intronic
1180004602 21:45014540-45014562 CAGAGGGGAGAGAGACAAGAGGG + Intergenic
1180698665 22:17770024-17770046 GAAAGGGGCCAGTGGCACGAAGG - Intronic
1180835875 22:18929155-18929177 CAGAGGGGCCTGAGCCATGGGGG - Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181325894 22:22045666-22045688 AAGAGGTGCCAGAGGCTAGAGGG + Intergenic
1182320540 22:29476042-29476064 GAGAGGGGCAAGAGGAGAGACGG + Intergenic
1182555958 22:31128392-31128414 AAGAGGGGCAGGAGGCAAGGTGG + Intronic
1182737643 22:32542273-32542295 CAGAGGGGCCATTAGGAAGAAGG + Intronic
1183354810 22:37352471-37352493 CAGAGTGGCCAGTGTCATGAAGG + Intergenic
1183356891 22:37364456-37364478 CAGAGGGGACAGGGGCCAGCTGG + Intergenic
1183440823 22:37822313-37822335 CAGAGGGGGCAGAGGAGAGGAGG + Intergenic
1183508073 22:38220391-38220413 GAGATGGGCCAGGGGCCAGATGG + Exonic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1185155602 22:49191759-49191781 TAGATGGCCCAGAGGCACGAGGG + Intergenic
1203285966 22_KI270734v1_random:154454-154476 CAGAGGGGCCTGAGCCATGGGGG - Intergenic
949305543 3:2636305-2636327 CAGAGGGGCCAAAGAAGAGAGGG - Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
950041212 3:9920626-9920648 CAGAGGGGACAGAGGCTAGGGGG - Intronic
950128930 3:10528410-10528432 CATGGGGCCCAGAGGCAAGGTGG - Intronic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
950506368 3:13397281-13397303 CAGAGAGGCCAGAGTCATGGTGG + Intronic
950991021 3:17437671-17437693 GAGAGGGGGCAGAGGAAGGAAGG + Intronic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
951670156 3:25172298-25172320 CAGAGGGGCAAGAGCAGAGAAGG + Intergenic
951718528 3:25674092-25674114 CAGAGGGGGCTGAGGCATCAGGG + Intergenic
951895897 3:27609510-27609532 TTGAGGGGCCAGAGACAGGAGGG - Intergenic
953170170 3:40500004-40500026 CATAAGGGCCAGAGGAAACAAGG - Intergenic
953724029 3:45381976-45381998 GAGAGTGGCCAGAGGCACGGGGG - Intergenic
955069401 3:55559704-55559726 GAGAGAGGCCAAAGGCAAGGAGG - Intronic
955320000 3:57967639-57967661 CTGAGGGGCAAAAGGCAAGAAGG + Intergenic
955372827 3:58368271-58368293 TAGAGGGGCTAGAGACAGGAGGG + Intronic
955379028 3:58422067-58422089 AAGAGGGGGCAGGGGCAACAAGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956750985 3:72343837-72343859 CAAGAGGGACAGAGGCAAGAGGG - Intergenic
957191953 3:77021323-77021345 AAGAGGGGCAAGAGACAGGAGGG - Intronic
957229489 3:77493646-77493668 CAAAGGGTCCAGGGGAAAGAAGG - Intronic
957614471 3:82509416-82509438 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
957923020 3:86771980-86772002 CAGAGGGGCTCGAGGCAGCAGGG - Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959601351 3:108190013-108190035 CAGAGGTGGCAGAGGCAGAAGGG + Intronic
959891683 3:111563073-111563095 CAGAAGGGCAAGAGACAAAAGGG + Intronic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961945592 3:130683632-130683654 CAAAGAGCCTAGAGGCAAGAGGG + Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
964242773 3:154616134-154616156 CAGAGGGGGCAGGGGCACTATGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
968226564 3:196976059-196976081 CAGCTGGGCCAGAGAAAAGAAGG - Intergenic
968522557 4:1040637-1040659 CAGAGGGGCACGTGGCAAGGGGG + Intergenic
968974750 4:3816189-3816211 CAGAGGGCACAGAGGTCAGAGGG - Intergenic
969365900 4:6694167-6694189 CAAGGGGCTCAGAGGCAAGAGGG + Intronic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
969614076 4:8242266-8242288 CAGAGGTGGCAGAGCCAGGAGGG + Intergenic
970449059 4:16149053-16149075 CAAAGGGTACAGAGGAAAGAGGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971412088 4:26384892-26384914 GGGAGAGGCAAGAGGCAAGAGGG - Intronic
972674895 4:41250744-41250766 CACAAGGTCCAAAGGCAAGAAGG - Intergenic
973713848 4:53655636-53655658 TAGAGGGACAAGGGGCAAGAAGG - Intronic
973730282 4:53816354-53816376 CACAGGGGATTGAGGCAAGAGGG - Intronic
974183567 4:58415587-58415609 CAGAGGTGCCAAAAGCCAGAGGG + Intergenic
975652881 4:76612038-76612060 GAGAGGAGGCAGAGGCAAGCAGG - Intronic
976208513 4:82644301-82644323 AAGAAGGGGCAGAAGCAAGATGG - Intronic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976686772 4:87822614-87822636 CAGAGAGGCCAGATGACAGATGG + Intronic
977792757 4:101127557-101127579 TAGAGGTTTCAGAGGCAAGAAGG + Intronic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979475984 4:121157733-121157755 CAGAGTGGCCACAGTCCAGAGGG + Intronic
979878853 4:125928868-125928890 CAGAGGTGGCAGTGGCTAGAGGG + Intergenic
980897272 4:138871957-138871979 CAAAGTGGTCAGAGGCAAGGGGG + Intergenic
981310916 4:143297402-143297424 CAGAAGGGCCAGGGTTAAGATGG - Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
984235952 4:177159376-177159398 AACAGGGGTCAGAGCCAAGATGG + Intergenic
984555964 4:181214078-181214100 CACAGGGGCCAGGGGCACCAAGG - Intergenic
984690025 4:182716015-182716037 AAGAGGAGTCAGAGGCAACAAGG - Intronic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985666318 5:1183276-1183298 CAGAAGGGGCAGAGACAAAAGGG + Intergenic
985721926 5:1493989-1494011 CAGAGGAGGAAGAGGCAGGAAGG + Intronic
987878336 5:23710274-23710296 GTGAGGGGACAGAGCCAAGATGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988492737 5:31718309-31718331 CAGATGGGCCTGGGGGAAGAAGG + Intronic
988634954 5:32972898-32972920 GTGAGGGGCCAGAGACAAGAAGG - Intergenic
988714046 5:33807067-33807089 CAGAGAGGCCAGAGGAGAAAGGG - Intronic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
989732427 5:44664575-44664597 CAGAGGGGACTGAGGCAGCAGGG - Intergenic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
990492240 5:56313897-56313919 CCCAGGAGCCAGAGGCAGGAGGG + Intergenic
991144352 5:63283412-63283434 CACAGGACCCAAAGGCAAGATGG + Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
991441605 5:66656130-66656152 CAGGTGGGCCAGAGGCACAAGGG + Intronic
992120525 5:73587598-73587620 CAGATGGGCCAGAGCCAGGAAGG - Intergenic
992838977 5:80668506-80668528 CAGAGGGGGCCGAGGCAGCAGGG + Intronic
994916153 5:105982618-105982640 CAAAGGGGCCCGAGGCAGCAGGG - Intergenic
996212657 5:120831422-120831444 AAGAGGGGGAAGAGCCAAGATGG + Intergenic
996522414 5:124441886-124441908 CAGAGGGGCAATAGACAGGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997383043 5:133450982-133451004 CAGAGGAGGGAGAGGCATGATGG + Intronic
998171990 5:139877907-139877929 TGGAGGGTCAAGAGGCAAGAAGG + Intronic
998546239 5:143030265-143030287 AAGAGGGGCCTGAGGCCTGAGGG - Intronic
999093521 5:148958158-148958180 CAGTGGGGTGAGAGTCAAGAAGG + Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002210626 5:177596820-177596842 CAAAGGGCCCAGAGGCCAGAGGG - Intergenic
1002587151 5:180256403-180256425 CAGGGGGGCAGGGGGCAAGAGGG + Intronic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004291547 6:14372140-14372162 CAGCGAGGGCAGAGGCAAGGAGG + Intergenic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1006568739 6:34982665-34982687 CAAAGGGGACACAGACAAGAAGG - Intronic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007123403 6:39402260-39402282 CAGAGGTGCCAGGGGCATGAGGG + Intronic
1007209513 6:40181099-40181121 GAGAGGGGCGAGAGACAGGAGGG - Intergenic
1007278300 6:40691611-40691633 CAGAGGGGCCACATGAAAGATGG - Intergenic
1007749390 6:44062853-44062875 GGGAGAGGGCAGAGGCAAGATGG - Intergenic
1008330712 6:50240969-50240991 CAGAGGGGGCCGAGGCAGCAGGG + Intergenic
1009054223 6:58316167-58316189 CAGAGGGGTGGGTGGCAAGATGG + Intergenic
1009393818 6:63173540-63173562 CAAAGAGCCCAGAGGAAAGAGGG - Intergenic
1009787458 6:68358247-68358269 CTGGGGGGTCAGGGGCAAGATGG + Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1010849921 6:80760742-80760764 CAGAGGGGGGTGAAGCAAGATGG - Intergenic
1011805931 6:91072444-91072466 AGGAGGGGCCAGGGGCAAAATGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012436059 6:99216166-99216188 AGGACTGGCCAGAGGCAAGAGGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1014007549 6:116437238-116437260 CAGAGGGCCCAGAGCCTACATGG + Exonic
1014987717 6:128032268-128032290 CATAGAGCCCAGAAGCAAGAGGG - Intronic
1015180402 6:130355760-130355782 AAGAGGGGTCAGAGACAAGAGGG + Intronic
1015217153 6:130763256-130763278 CAGATGGGCTAGCAGCAAGAGGG + Intergenic
1015434670 6:133172379-133172401 CAGAGGGGGCTGAGGCCACAGGG - Intergenic
1016006685 6:139095917-139095939 GAGAGGGGACAAAGCCAAGAAGG - Intergenic
1016375313 6:143414431-143414453 CAGAGGGCCAAGAGCCAAAAGGG + Intergenic
1017533564 6:155322236-155322258 AAGAGGTTCAAGAGGCAAGAAGG + Intergenic
1017649646 6:156569064-156569086 CAGCTGGCCCAGAGTCAAGACGG + Intergenic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1020051714 7:5086242-5086264 CAGGGGGGCCAGGGACAAGGTGG + Intergenic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1025790062 7:64680662-64680684 CTGAAGGGCCAGGGGCCAGAAGG + Intronic
1026975206 7:74493693-74493715 CAGAGGGGACAGAGCCGAGGTGG - Intronic
1028054619 7:86226369-86226391 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
1028473655 7:91231044-91231066 CAGAGGGGACAGTTACAAGATGG - Intergenic
1029654012 7:101912577-101912599 CAGAGGGGCCGGTGGGGAGAGGG - Intronic
1029973832 7:104814741-104814763 CAGAGGGGGCAGATGCAGCAGGG + Intronic
1030900371 7:115115995-115116017 CAGAGGAGACAAAGACAAGAGGG - Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031143579 7:117972970-117972992 CACAGGGCCCAGAGGCGAGGGGG - Intergenic
1031325125 7:120386375-120386397 TTGAGGGGGAAGAGGCAAGAAGG - Intronic
1031476000 7:122222538-122222560 CAAAGAGGCCAGAGGCCACAAGG + Intergenic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1031859037 7:126957653-126957675 CAGAGGGGGCTGAGGCAGCAGGG - Intronic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032277885 7:130475566-130475588 CTGAGGTGGCAGATGCAAGAGGG - Intergenic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1033526185 7:142216129-142216151 CAGAGAGGCCAAATGCAGGATGG - Intronic
1033737027 7:144232367-144232389 CACATGGGCCAGAGCCAGGAGGG + Exonic
1033746030 7:144318579-144318601 CACATGGGCCAGAGCCAGGAGGG - Exonic
1034392866 7:150800246-150800268 CAGAGGGTCCTGCGGCAAGAGGG + Intronic
1034827009 7:154274992-154275014 CTGAGGGTCCAGAGGCATGGGGG - Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035524329 8:300540-300562 GAGAGGGGCTTGAGGCAGGAAGG + Intergenic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035750686 8:1994021-1994043 CAGAGGGGAGTGAGGCATGAGGG + Intronic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1036778497 8:11629752-11629774 CAGAGAAGACAGAGGCGAGAAGG + Intergenic
1037150183 8:15626770-15626792 CAGAGGGGACTGAGGCAGCAGGG - Intronic
1037617342 8:20531364-20531386 CAGAGATGCCAGGGACAAGAGGG + Intergenic
1037773153 8:21814922-21814944 GAGAGGAGCCAGGGGCAGGAAGG - Intergenic
1038342191 8:26695809-26695831 AACAGGGACCAGAGGCGAGAAGG - Intergenic
1038684427 8:29703253-29703275 GGGAGGGGCCAGAGGCAGAATGG + Intergenic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1040010883 8:42660084-42660106 CAGAGGGGAGTGAGGCAAGCTGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1041132708 8:54719142-54719164 CAGAGGGGCCATAGGCAGCATGG - Intergenic
1041153503 8:54960523-54960545 CAGGGGTGCCTGAGGCCAGAGGG - Intergenic
1041211958 8:55560368-55560390 CAGAGGGGGCGGGGCCAAGATGG - Intergenic
1041955998 8:63558717-63558739 CAGAGGGGGCTGAGGCAGCAGGG - Intergenic
1042273950 8:66984086-66984108 CAGAAGAGACAAAGGCAAGAGGG + Intronic
1044867841 8:96589900-96589922 CCGGGGGGCCAGAGGCAAAGGGG + Intronic
1045648008 8:104317985-104318007 CTGAGAGGCTAGAAGCAAGATGG + Intergenic
1045815207 8:106270463-106270485 CACAGGGGGCAGAGGCCAGCCGG - Intronic
1045873315 8:106950137-106950159 CAGAGGGGACCGAGGCAGCAGGG - Intergenic
1046503811 8:115111730-115111752 CAGAGGGGGCTGAGGCAGCAGGG + Intergenic
1046770567 8:118112583-118112605 CAGAGGGGGCTCAGGCAAGGCGG - Intergenic
1047104724 8:121720092-121720114 CAGAGGGGGCTGAGGCAGCAAGG + Intergenic
1047769369 8:128018371-128018393 CAGAGGTGACAGAGGCACAAAGG - Intergenic
1048999654 8:139816529-139816551 CAGAGGGGACAGAGGAGAGGTGG + Intronic
1049048281 8:140170444-140170466 CAGAGAGGCCACAGGCAAAGAGG - Intronic
1049325002 8:142017161-142017183 CACATGGGCCAGGGGCAGGAAGG + Intergenic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049352540 8:142171805-142171827 CAGAGGGGCCAGACGCTCGCTGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702496 8:144021510-144021532 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702703 8:144022357-144022379 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049838203 8:144753981-144754003 CAGTGGGGCCACTGGCAACAGGG + Intronic
1049851971 8:144837472-144837494 CAGAGGGGACAGAGGCACCAAGG + Exonic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1051219889 9:14837078-14837100 CATATGGGCCAAGGGCAAGAAGG - Intronic
1051618845 9:19032138-19032160 CAGAGGAGCAACAGGCAAGAGGG - Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1056570194 9:87808097-87808119 CAGAGGGGGCAAATGCAAGTGGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057294564 9:93827717-93827739 CAGAGAGGGCAGAGGCACGGTGG - Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1058860458 9:109113075-109113097 CAGCGGGGCCAGGGGCAGGGCGG + Intronic
1058907753 9:109495510-109495532 GAGTGGGGCCAGGAGCAAGAGGG - Intronic
1060036593 9:120261331-120261353 CAGAGGGGCCAGGGATAAGGCGG + Intergenic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1060268410 9:122125592-122125614 CAGTGGGGCCCCAGGCAGGACGG + Intergenic
1060546708 9:124466212-124466234 GTGAGGGGCCAGAAGCAAGCAGG - Intronic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1060874803 9:127075044-127075066 CTGAGGGGCAAGAGGCCTGAAGG - Intronic
1061167878 9:128934849-128934871 CAGAGGGGCCCAAGACCAGAGGG - Intronic
1061801824 9:133116918-133116940 AGGAGGGGCCAGAGACAGGAAGG + Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186087435 X:6005607-6005629 CAGAGGGTTGAGAGACAAGAGGG - Intronic
1187182765 X:16958639-16958661 GAGAGGGGCCAGTGGGATGAGGG + Intronic
1188246470 X:27841098-27841120 CTGAGGTGTCAGAGGCAAGGTGG - Intergenic
1188881260 X:35494457-35494479 CAAAGGGTCCCCAGGCAAGAAGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190621048 X:52287563-52287585 CAGAGGGGCCTGAGGGAGCAAGG - Intergenic
1190903607 X:54703014-54703036 CAGAAGGGCCAGTGGATAGAAGG + Intergenic
1192089819 X:68141961-68141983 AAGAGAGGCAAGAGCCAAGACGG + Intronic
1194250040 X:91563093-91563115 CCGAGGGGAGAGAGGCAAGAAGG - Intergenic
1195755987 X:108199087-108199109 CAGAGGGGCCAAGAGAAAGAAGG + Intronic
1195850371 X:109276137-109276159 AAGATGGGGCAGAGGAAAGAAGG + Intergenic
1196465424 X:115967717-115967739 GAGAGGAGCCAGAACCAAGATGG - Intergenic
1196846077 X:119897669-119897691 CAGAGCAGCCAGAGGCTAAAGGG - Intronic
1197148073 X:123190589-123190611 CAGGGGGGACAGCAGCAAGAAGG + Intronic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198770312 X:140123864-140123886 CAGAGAGGCAAAAGGAAAGATGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201988485 Y:19995636-19995658 CTCAGGGGGCTGAGGCAAGAAGG - Intergenic