ID: 1129360908

View in Genome Browser
Species Human (GRCh38)
Location 15:75023586-75023608
Sequence GGGGCCGCTCCCAAATATCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129360908_1129360921 17 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360921 15:75023626-75023648 GGTGAGCAGTGGAAGGGGGCTGG 0: 1
1: 0
2: 4
3: 55
4: 725
1129360908_1129360909 -10 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360909 15:75023599-75023621 GAGCGGCCCCGAGACGCGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 94
1129360908_1129360922 18 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360922 15:75023627-75023649 GTGAGCAGTGGAAGGGGGCTGGG 0: 1
1: 0
2: 7
3: 48
4: 448
1129360908_1129360923 25 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360923 15:75023634-75023656 GTGGAAGGGGGCTGGGAAGCTGG 0: 1
1: 0
2: 12
3: 119
4: 1165
1129360908_1129360915 6 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360915 15:75023615-75023637 CGCCTGGCGCGGGTGAGCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 153
1129360908_1129360910 -5 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360910 15:75023604-75023626 GCCCCGAGACGCGCCTGGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 83
1129360908_1129360917 10 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360917 15:75023619-75023641 TGGCGCGGGTGAGCAGTGGAAGG 0: 2
1: 0
2: 1
3: 16
4: 164
1129360908_1129360924 26 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360924 15:75023635-75023657 TGGAAGGGGGCTGGGAAGCTGGG 0: 1
1: 0
2: 3
3: 67
4: 718
1129360908_1129360920 13 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360920 15:75023622-75023644 CGCGGGTGAGCAGTGGAAGGGGG 0: 1
1: 1
2: 0
3: 19
4: 205
1129360908_1129360919 12 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360919 15:75023621-75023643 GCGCGGGTGAGCAGTGGAAGGGG 0: 1
1: 1
2: 0
3: 13
4: 135
1129360908_1129360918 11 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360918 15:75023620-75023642 GGCGCGGGTGAGCAGTGGAAGGG 0: 1
1: 1
2: 0
3: 12
4: 158
1129360908_1129360912 -4 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129360908 Original CRISPR GGGGCCGCTCCCAAATATCG CGG (reversed) Exonic
900238080 1:1601803-1601825 GGGGCGGCCCCCAACTATCTTGG + Intergenic
1074440838 10:113476321-113476343 GGGGCTGCTCCGAAAGATCTAGG - Intergenic
1104329924 12:127835198-127835220 AGGGCCTCTCCTAAATATAGAGG - Intergenic
1107516135 13:41131748-41131770 GAGGCTGCTCCCAAAGAGCGGGG - Exonic
1122205347 14:100145461-100145483 GGGGCCACTCCCAGGTATAGGGG + Exonic
1127616839 15:60694599-60694621 GGGGCCTCGCCCAAACCTCGAGG + Intronic
1128468318 15:67930985-67931007 GGGGCCTCTCCAAAATAGCTAGG + Intergenic
1129360908 15:75023586-75023608 GGGGCCGCTCCCAAATATCGCGG - Exonic
1133976298 16:10601842-10601864 GGGACCCCACCCAGATATCGAGG - Intergenic
1160819528 19:1051549-1051571 GCAGCAGCTCCCAAATACCGCGG - Exonic
1161053327 19:2176955-2176977 GGGCCTGCTCCCTCATATCGGGG - Intronic
941766043 2:169297618-169297640 GGGGCAGCTCCCAATTATGGGGG - Intronic
1169900741 20:10549514-10549536 GGGCCAGCTCCCAAATAAAGGGG + Intronic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
975590970 4:75999575-75999597 GGGTCCACTGCCAAATATCTGGG + Intergenic
1019897399 7:3993211-3993233 ATGGCCTCTCCCAAATATCAAGG - Intronic
1028048506 7:86152981-86153003 GTGGCCCCTCCCAAATCTCATGG - Intergenic
1030517024 7:110551001-110551023 GAGGCCGCTCCTTAATATCCTGG - Intergenic
1189329378 X:40134031-40134053 GGAGCCCCTCCCAAATTTCTAGG - Intronic
1192803048 X:74485547-74485569 GCGGCCACTCCCAAATGGCGCGG + Intronic
1196101713 X:111853797-111853819 GGGGCCTCCCCCAACTGTCGTGG - Exonic