ID: 1129360912

View in Genome Browser
Species Human (GRCh38)
Location 15:75023605-75023627
Sequence CCCCGAGACGCGCCTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129360908_1129360912 -4 Left 1129360908 15:75023586-75023608 CCGCGATATTTGGGAGCGGCCCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 89
1129360904_1129360912 18 Left 1129360904 15:75023564-75023586 CCGCGGGAGAGCGGCAGAGATAC 0: 1
1: 0
2: 1
3: 1
4: 53
Right 1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 89
1129360902_1129360912 29 Left 1129360902 15:75023553-75023575 CCAGTCAGATTCCGCGGGAGAGC 0: 1
1: 0
2: 0
3: 7
4: 24
Right 1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129360912 Original CRISPR CCCCGAGACGCGCCTGGCGC GGG Exonic
901007717 1:6179880-6179902 CGCCGAGACGGGCCGGGCCCAGG - Intronic
903288267 1:22290667-22290689 CCCCTAGACCCACCTGGCGCTGG + Intergenic
904591395 1:31617559-31617581 CCCCGAGACCCGCAGGGCGGAGG - Intergenic
905912141 1:41662341-41662363 CCCGGAGCCGCGCCCGCCGCCGG - Intronic
907689154 1:56645264-56645286 CCCCGAGCCGCGAGGGGCGCGGG - Intronic
924415218 1:243850467-243850489 CCCCGGGGCGCGCCCGGCGCGGG + Intronic
1062774692 10:135468-135490 GCCCGAGAGGCGCCGGGCGGCGG + Intronic
1062835180 10:630849-630871 CCCTGAGACCCGTCTGGCACAGG + Intronic
1063418196 10:5890168-5890190 CCCCGGGAAGCGCCCGCCGCCGG - Intergenic
1070540297 10:77410749-77410771 CCCCGAGACGGGACTGGGTCTGG - Intronic
1072190661 10:93074157-93074179 CCCAGAGCCGCGCCGGGCTCCGG - Intronic
1072804838 10:98417777-98417799 CCCAGAGAGGCCTCTGGCGCTGG - Intronic
1075048587 10:119165508-119165530 CCCCTAGTCGCGCCGGGCCCGGG + Intronic
1076657789 10:132036368-132036390 CCCCGTGCTGCGCATGGCGCTGG + Intergenic
1077473670 11:2776497-2776519 CCCCCAGACTGGCCTGGAGCTGG + Intronic
1079126374 11:17720918-17720940 CCCCGAGCGGCGCCCGGCGGCGG + Exonic
1081911289 11:46701400-46701422 CCGCGAGCCGCGCCTGGGCCTGG + Exonic
1089325362 11:117653163-117653185 CCCCGAGACAAGCCTGGCTGAGG - Intronic
1093675995 12:21941369-21941391 CCGCGCGCCGCGCCTGGGGCCGG + Intronic
1097190340 12:57216625-57216647 CCCGGACACGCCCCTGGCCCAGG - Intergenic
1102599758 12:114020851-114020873 CTCTGAGACGAGCCTGGGGCTGG + Intergenic
1103370267 12:120414076-120414098 CCCAGGGCCTCGCCTGGCGCCGG - Intergenic
1106036668 13:26050720-26050742 CGCCGAGGCGCGCCTGGACCAGG - Exonic
1113472604 13:110557665-110557687 CCCAGAGACGCAGCTGGAGCTGG + Intronic
1121108696 14:91297276-91297298 TCCCGAGGCTCCCCTGGCGCTGG + Intronic
1123036046 14:105472362-105472384 CCCTGAGATGCCCCTGGCCCTGG - Intergenic
1128263994 15:66252522-66252544 TCCCGAGACGCGGCTGCCGCTGG + Intronic
1129221431 15:74133886-74133908 CCAAAACACGCGCCTGGCGCCGG + Exonic
1129360912 15:75023605-75023627 CCCCGAGACGCGCCTGGCGCGGG + Exonic
1129676159 15:77633206-77633228 CCCCGACACCCGGCTGGCCCGGG - Intronic
1129933772 15:79432518-79432540 CTCCGAGGCGCCCCGGGCGCAGG - Exonic
1130007166 15:80110910-80110932 CCCTGAGACAGGCCTGGCCCTGG + Intronic
1132719829 16:1310031-1310053 CCCCGAGGTGCGCCTGGCGCGGG + Intronic
1132789608 16:1678347-1678369 CCCCGCGCCGCACCTGGAGCCGG - Exonic
1132805660 16:1773932-1773954 CCGCGAGACGCGCACGGCCCAGG - Intronic
1136622906 16:31442209-31442231 CACCAAGCCTCGCCTGGCGCGGG + Intronic
1138392732 16:56682312-56682334 CCCCGCGGTGCGCCCGGCGCTGG + Intronic
1142271897 16:89094125-89094147 CCCCGCGAGCCGCCTGGGGCCGG + Intronic
1142359826 16:89620767-89620789 CCCCGAGACTCACCATGCGCGGG - Exonic
1142860048 17:2755811-2755833 CCCCGAGGCCCGGCCGGCGCGGG + Intergenic
1143495761 17:7311870-7311892 CCCCGAGCCTGGCCTGGCTCTGG + Exonic
1144761589 17:17710472-17710494 CCCAGAGACCCTCCTGGCCCTGG + Intronic
1145256222 17:21323903-21323925 CCCCGAGACACTCCTTGCCCTGG + Intergenic
1149213270 17:54327699-54327721 CCCCGAGAAGTGCCTGGAGTTGG - Intergenic
1149512533 17:57255937-57255959 CCCCGAGACGCCCCAGGATCGGG - Intronic
1150840453 17:68601291-68601313 CCCCGAGCCTGGCCTGGCGCCGG + Exonic
1153320705 18:3771450-3771472 CCCGGAGACGCGCTCGGCCCGGG + Intronic
1157614048 18:48976313-48976335 GCCCGAGCCGCGCCCGGCCCGGG - Intergenic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1161043063 19:2120389-2120411 CCTCCAGAGGGGCCTGGCGCAGG + Intronic
1161068994 19:2251198-2251220 CTCCGCGCCGCGCCTGGCCCTGG + Exonic
1162079242 19:8209017-8209039 CCCCGCGGCGCGCCTGGCCCGGG - Intronic
1162914059 19:13865154-13865176 CCCCGCGCCGCGCCGGGCGGTGG - Intronic
1164528290 19:29027775-29027797 TCCTGAGAGGTGCCTGGCGCTGG + Intergenic
1166571294 19:43798678-43798700 CCCCGAGACGTGCTAGGCGCGGG - Intronic
1167258486 19:48444302-48444324 CCCGGAGGCGCGGCTGGGGCCGG - Exonic
1168071874 19:53958130-53958152 CCCCGAGATGGGGCTGGGGCTGG - Intergenic
933666677 2:84970726-84970748 CCCCTAGCCCCGCCTGGGGCGGG - Intergenic
946404335 2:219484483-219484505 CCGCGAGTCGCCCCTGTCGCTGG + Exonic
1168756866 20:324521-324543 CCCCGCCACGCGCCTCGTGCCGG + Intergenic
1176123566 20:63465069-63465091 CCCCGGGAAGCGACAGGCGCAGG + Intronic
1177871035 21:26573092-26573114 GCCCGGGACGCGCCCGGCCCGGG - Exonic
1179596460 21:42446036-42446058 CCCCCAGGAGCGCCTGGGGCTGG - Intronic
1180967009 22:19795485-19795507 CCCCGAGACACGCCATGTGCTGG + Intronic
1181269689 22:21652021-21652043 GCCCGAGACTCGGCCGGCGCCGG + Intergenic
1181811177 22:25404873-25404895 CCCGGAGGCGGGCCTGGCCCGGG - Intronic
1183467342 22:37986396-37986418 GCCTGAGACCCGCCTGGGGCAGG + Intronic
1183956247 22:41382182-41382204 CACCGAGGCGCGCCTCGCGCGGG - Exonic
1185289084 22:50015068-50015090 CACGGAGACGCGCGTGGCTCCGG + Intergenic
961453786 3:127014483-127014505 CCCCGAGACGGGCCCGAGGCAGG + Exonic
968434007 4:575821-575843 CCCCGGGACGCGCCCCTCGCGGG - Intergenic
970332992 4:15003661-15003683 CCCGGAGGTGCGCTTGGCGCGGG + Exonic
987032237 5:13986695-13986717 CCCCGAGACAACCCTGGCCCAGG + Intergenic
991371683 5:65925977-65925999 CCCCGAGACGCGCAGGGGGCGGG - Intergenic
997292532 5:132747888-132747910 CCGCGAGGCGCGCCTGTGGCGGG + Exonic
998446099 5:142199589-142199611 CCCAGAGAGGCGCCCGGTGCCGG - Intergenic
1001035061 5:168291674-168291696 GCCCGAGCCGCACCTGGCGGAGG + Intronic
1001907455 5:175484647-175484669 CGCCGAGACGCGCCCTGTGCTGG - Intronic
1002099154 5:176848805-176848827 TCCCGAGACGCGCAGGGCCCAGG - Intronic
1002279987 5:178124333-178124355 CTCCGAGACGCCCCAGGCTCAGG - Exonic
1004924179 6:20402794-20402816 CCCCCCGACCCTCCTGGCGCCGG - Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1006152320 6:31996132-31996154 GCCCGAGAAGCGCCTGTCGGAGG + Intronic
1006158621 6:32028870-32028892 GCCCGAGAAGCGCCTGTCGGAGG + Intronic
1007390385 6:41546987-41547009 GCCCGAGACGCGCTGGGCGCCGG + Intronic
1018918375 6:168152785-168152807 CCTCGACACGCTCCTGCCGCTGG - Intergenic
1019352671 7:562276-562298 CCCTGAGAGGTGCCTGGGGCTGG - Intronic
1019624818 7:2010804-2010826 CCCCGAGAGGCGCCTTCCCCAGG + Intronic
1023056237 7:36292153-36292175 CCGCCAGAAGCGCCTGGCACGGG - Intronic
1029487447 7:100852363-100852385 TCCCGTGACGCACCTGGCCCAGG + Intronic
1049102576 8:140590148-140590170 CACAGAGACGCGTCTGGCCCAGG + Intronic
1049710430 8:144060715-144060737 CCCCGAGGCGAGGCTGGTGCGGG - Intronic
1052781218 9:32783403-32783425 CCCCGGGCAGCGCCTGCCGCCGG + Intergenic
1055044520 9:71910850-71910872 TCCCGAGTCTCGCCTCGCGCCGG + Exonic
1060849321 9:126861059-126861081 TCCCGAGACGCCCCGGGCGGAGG - Intronic
1061873192 9:133531490-133531512 CCCTGAGACCCCCCTGGGGCTGG - Intergenic
1062064329 9:134518092-134518114 TCCCGAGGCGCTCCTGGCCCGGG + Intergenic
1062162264 9:135087154-135087176 CCCCGACGCCCCCCTGGCGCTGG + Intronic
1062181327 9:135192736-135192758 CCCCGAGACACTCCAGGGGCGGG - Intergenic
1062539496 9:137035300-137035322 CCCTGAGACGCCCCTGGGGCTGG - Exonic
1190732407 X:53234472-53234494 CCCCCAGCCGCGCCTGCTGCTGG + Exonic