ID: 1129361286

View in Genome Browser
Species Human (GRCh38)
Location 15:75026196-75026218
Sequence TATCCTAGCACCAGTTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129361281_1129361286 20 Left 1129361281 15:75026153-75026175 CCTCAGAGATAAAATTTGGCTTC 0: 1
1: 0
2: 3
3: 15
4: 173
Right 1129361286 15:75026196-75026218 TATCCTAGCACCAGTTGGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129361286 Original CRISPR TATCCTAGCACCAGTTGGCT AGG Intronic
901653992 1:10758922-10758944 TATCCTAGCATCGGCTGTCTTGG - Intronic
907697726 1:56750650-56750672 TATACTAGCTCCTGTTGTCTAGG - Intronic
911631620 1:100190166-100190188 CACCCTAGCACCAATTGGTTTGG - Exonic
917371520 1:174298703-174298725 GATCTTAGCACCAGTTATCTGGG - Intronic
920196582 1:204231363-204231385 GATCCTAGCACCAGTCCCCTGGG - Intronic
923108517 1:230872376-230872398 TATAAAACCACCAGTTGGCTGGG - Intergenic
923421131 1:233816279-233816301 TAACCTACCACCAATTGTCTGGG - Intergenic
1071520580 10:86329500-86329522 TATCCTTTCACCAGTAGGCAGGG - Intronic
1084461794 11:69300332-69300354 CATTCTCGCACCAGCTGGCTTGG - Intronic
1086092477 11:83018908-83018930 TATCCCAGCACCATTTGTCAAGG + Intronic
1087364596 11:97202575-97202597 TATACTAGCAGCAGCTAGCTAGG + Intergenic
1089189531 11:116643991-116644013 TATCCCAGCTCCAGTTCCCTGGG - Intergenic
1101055655 12:100910332-100910354 TATTCTAGCACAAGTTAACTGGG - Intronic
1106297616 13:28431636-28431658 TACCCTGGCCCAAGTTGGCTAGG + Intronic
1108609355 13:52069162-52069184 TATCTTTGCATCAGTTTGCTGGG - Intronic
1119430428 14:74564676-74564698 AATTATAGCACCAGTTGGCTGGG - Intronic
1122689491 14:103525026-103525048 TATGCTGGCACCAGTTCCCTGGG - Intergenic
1123901856 15:24885201-24885223 TATCCTTGCACCGGTAGCCTAGG + Intronic
1124996232 15:34725732-34725754 TCTCCTAGCACGTGTTGGTTGGG - Intergenic
1125150370 15:36523899-36523921 GACCTTGGCACCAGTTGGCTGGG - Intergenic
1125409778 15:39393813-39393835 TAGCATAGCACCAGCTGACTTGG + Intergenic
1129361286 15:75026196-75026218 TATCCTAGCACCAGTTGGCTAGG + Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1134817364 16:17216788-17216810 TATCCTGGAATCAGTTTGCTTGG - Intronic
1135720396 16:24812647-24812669 TAGCCTAGGAGCAGTAGGCTAGG + Intronic
1136084654 16:27876272-27876294 TATCTTAGGACAAGTTTGCTGGG - Intronic
1137780378 16:51093326-51093348 TGTCTTAGCAGCAGTTGGGTTGG - Intergenic
1139300711 16:65942998-65943020 CACCCTAACAGCAGTTGGCTAGG - Intergenic
1140780637 16:78293420-78293442 TAACCTAGCATCATTTCGCTGGG + Intronic
1143622120 17:8086653-8086675 TCGCCTAGCAGCAGGTGGCTGGG + Intronic
1149990375 17:61379880-61379902 TCTCCCAGCTCCAGTTGGCCAGG + Intronic
927960408 2:27237643-27237665 TAGCCTGGCACCAGTGGCCTGGG - Intronic
1184198758 22:42950602-42950624 TAACTTTGCACTAGTTGGCTGGG - Intronic
958495004 3:94833724-94833746 TATCCCAGCACCATTTGAATAGG - Intergenic
958675786 3:97266534-97266556 AATCCTGGGACCAGTTGTCTGGG - Intronic
966340875 3:178923969-178923991 TCTTCTGGCCCCAGTTGGCTAGG - Intergenic
970984847 4:22145143-22145165 TATCCAAGCACCATTTGAATAGG + Intergenic
976333589 4:83860470-83860492 TATCATAGCACCAGTTCTTTGGG - Intergenic
977571201 4:98631593-98631615 CTTCCTAGCAGCAGTTGGATGGG - Intronic
982694106 4:158580191-158580213 TATCCTAGGGCCAGGTAGCTGGG - Intronic
986779067 5:11047678-11047700 AATCCTAGCAGAAGTAGGCTGGG + Intronic
1004804776 6:19190929-19190951 AATCCTAGCAACAGTTGGTTGGG + Intergenic
1025739548 7:64183947-64183969 TATCCTAGCACCAGCGGGAGAGG - Intronic
1027218318 7:76198313-76198335 TGGCCTAGCACCAGTCAGCTTGG - Intergenic
1027944662 7:84729324-84729346 TTTCCTGGCTCCAGTTTGCTTGG - Intergenic
1032485621 7:132285175-132285197 TATCCTAGTGCCCATTGGCTGGG - Intronic
1035171670 7:157020848-157020870 TATCCCAGAACCACTGGGCTGGG - Intergenic
1037901372 8:22691336-22691358 TGTCCTGGCACCAGTTGGAAGGG + Exonic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1043644164 8:82497028-82497050 TAACCTAGGAACAGTAGGCTAGG - Intergenic
1046246850 8:111574942-111574964 TAGACTATCACCAGTTGCCTGGG - Intergenic
1051592239 9:18788128-18788150 TTTCATATCACCATTTGGCTAGG - Intronic
1056128782 9:83563809-83563831 TATCCTACCACAAGATGCCTGGG + Intergenic
1186095274 X:6094523-6094545 TATCCAAGTCCCAGTTGGCCTGG + Intronic
1189966775 X:46381797-46381819 TATGAGAGCACCAGTTGGTTAGG - Intergenic
1194614707 X:96086796-96086818 TCTGCTAGCAGCAGTTAGCTAGG - Intergenic
1196682360 X:118482193-118482215 TATCCCAGCACCATTTGGTGGGG + Intergenic
1202386408 Y:24330819-24330841 AATCCTAGCAGCTGCTGGCTTGG - Intergenic
1202484378 Y:25339309-25339331 AATCCTAGCAGCTGCTGGCTTGG + Intergenic