ID: 1129367353

View in Genome Browser
Species Human (GRCh38)
Location 15:75064513-75064535
Sequence CAACCCTCGAACCAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 3, 1: 10, 2: 6, 3: 15, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129367341_1129367353 21 Left 1129367341 15:75064469-75064491 CCCCCAGATAGTCCTTTGGGGAG 0: 4
1: 5
2: 5
3: 16
4: 119
Right 1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG 0: 3
1: 10
2: 6
3: 15
4: 103
1129367343_1129367353 19 Left 1129367343 15:75064471-75064493 CCCAGATAGTCCTTTGGGGAGAA 0: 6
1: 7
2: 14
3: 24
4: 120
Right 1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG 0: 3
1: 10
2: 6
3: 15
4: 103
1129367347_1129367353 9 Left 1129367347 15:75064481-75064503 CCTTTGGGGAGAATGTGGCAGGT 0: 1
1: 5
2: 8
3: 35
4: 408
Right 1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG 0: 3
1: 10
2: 6
3: 15
4: 103
1129367342_1129367353 20 Left 1129367342 15:75064470-75064492 CCCCAGATAGTCCTTTGGGGAGA 0: 5
1: 4
2: 9
3: 23
4: 144
Right 1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG 0: 3
1: 10
2: 6
3: 15
4: 103
1129367344_1129367353 18 Left 1129367344 15:75064472-75064494 CCAGATAGTCCTTTGGGGAGAAT 0: 5
1: 8
2: 6
3: 29
4: 135
Right 1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG 0: 3
1: 10
2: 6
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129367353 Original CRISPR CAACCCTCGAACCAGGGACA AGG Intronic
901492028 1:9601568-9601590 CAAGCCTTGTACCAGTGACATGG - Intronic
902225267 1:14992728-14992750 AATCGCTCGAACCCGGGACATGG - Intronic
902915360 1:19635547-19635569 AATCACTTGAACCAGGGACAGGG - Intronic
904759744 1:32794261-32794283 AATCCCTTGAACCAGGGAGACGG + Intronic
904897579 1:33828504-33828526 CAACACTAGAGCCAGAGACAAGG - Intronic
909112941 1:71503104-71503126 CTACTCTCAAACCAGGGACAAGG + Intronic
914989380 1:152485279-152485301 TAACCCTCGAACCAGGGACAAGG - Intergenic
917321846 1:173790677-173790699 AATCCCTTGAACCTGGGACACGG + Intergenic
922511408 1:226171232-226171254 AATCCCTTGAACCAGGGAGATGG - Intronic
924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG + Intergenic
924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG + Intergenic
1063005416 10:1965557-1965579 CAACCCTCAAGCCAATGACAAGG - Intergenic
1064152864 10:12879523-12879545 CCCCACTGGAACCAGGGACAGGG - Intergenic
1065601913 10:27377747-27377769 GAACCCTTGAACCAGGGAGGCGG - Intergenic
1072552907 10:96492940-96492962 CAACACTCTATCCAGAGACAGGG + Intronic
1073262881 10:102203798-102203820 CAACCCTGCAGCCAGGGACAAGG - Intergenic
1073514752 10:104066338-104066360 TAACCCTTGAACCAGGGACAAGG + Intronic
1081413001 11:42782049-42782071 AAACCATAGCACCAGGGACAGGG + Intergenic
1081487791 11:43545411-43545433 CAACTCTTGAAACAGGGCCAAGG + Intergenic
1082744912 11:56950873-56950895 CAACCCTCAAACCAGGGACAAGG + Intergenic
1083830713 11:65231557-65231579 AATCCCTTGAACCCGGGACACGG - Intergenic
1084025063 11:66442906-66442928 TAACCCTCGAACCAGGGACAAGG - Intronic
1084858556 11:72003886-72003908 CACCCCTCGAGCCAAGGGCAAGG - Exonic
1084872816 11:72109426-72109448 GAACCCTGGACCCAGGGCCAGGG + Exonic
1090457040 11:126859164-126859186 CATCCTTGGAACCAAGGACAGGG - Intronic
1091388612 12:111354-111376 TAGTCCTCAAACCAGGGACAAGG - Intronic
1091826650 12:3517804-3517826 TAATCCTCAAACCAGGGAAAAGG + Intronic
1095312828 12:40720840-40720862 AATCCCTCGAACCAGGGAGTTGG + Intronic
1100739565 12:97576460-97576482 CATCCCACTAACCAGTGACAGGG - Intergenic
1103533440 12:121618481-121618503 GAACCCTTGAACCCGGGAGACGG - Intergenic
1103754828 12:123196261-123196283 AATCCCTTGAACCAGGGAGATGG + Intronic
1105369166 13:19787618-19787640 AATCCCTCGAACCAGGGAGGCGG + Intergenic
1108935847 13:55879086-55879108 CAACCCTCAAACCAGAGACAAGG - Intergenic
1109428580 13:62200514-62200536 AATCACTTGAACCAGGGACATGG + Intergenic
1110691041 13:78429967-78429989 TAATCCTCAAACCAGGGACAAGG - Intergenic
1111586253 13:90288032-90288054 CAAGCCTTGAACCAGGGACAAGG + Intergenic
1113520067 13:110934284-110934306 CAACCCTCAAACCAGGGACAAGG + Intergenic
1116868223 14:50048492-50048514 CATCCCTAGAACCCGGCACAGGG + Intergenic
1118693458 14:68361760-68361782 AATCTCTCGAACCTGGGACATGG - Intronic
1120342547 14:83240482-83240504 GAACCATCTATCCAGGGACAGGG - Intergenic
1125062251 15:35438342-35438364 CATCGCTTGAACCAGGGACATGG - Intronic
1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG + Intronic
1132094366 15:98970950-98970972 CAACCCTAGAACCAGGACCCGGG + Intronic
1133115225 16:3574626-3574648 CAACCCTGGACCCAAGGTCATGG - Intronic
1136654943 16:31703959-31703981 CAACCCCCGAGCCAAGGAGAGGG - Intergenic
1136722758 16:32337972-32337994 CAATGCTCAGACCAGGGACAGGG + Intergenic
1136841080 16:33543971-33543993 CAATGCTCAGACCAGGGACAGGG + Intergenic
1138094209 16:54199508-54199530 CCACCCCCGATTCAGGGACAGGG - Intergenic
1139545297 16:67647101-67647123 CCACCCTCCCACCAGGGACCTGG + Exonic
1140854896 16:78969354-78969376 AATCCCTTGAACCAGGGAGATGG - Intronic
1141392504 16:83676476-83676498 TAAACCTCAAACCAGGGCCAGGG - Intronic
1141676055 16:85518021-85518043 CAAGCCGGGCACCAGGGACACGG + Intergenic
1203003673 16_KI270728v1_random:179792-179814 CAATGCTCAGACCAGGGACAGGG - Intergenic
1203135281 16_KI270728v1_random:1716199-1716221 CAATGCTCAGACCAGGGACAGGG - Intergenic
1203151245 16_KI270728v1_random:1844268-1844290 CAATGCTCAGACCAGGGACAGGG + Intergenic
1144692603 17:17278062-17278084 CAATCCTTGAACCCGGGAGATGG + Intronic
1146449963 17:32965079-32965101 CAACTCTCGAACCAGGGACAAGG + Intergenic
1146965905 17:37029650-37029672 AAACCCTTGAACCCGGGAGATGG - Intronic
1147369327 17:39980898-39980920 TAACCCTCGCACCGGGGACCAGG - Exonic
1148050417 17:44767510-44767532 CTTCCCTCAGACCAGGGACAGGG + Intronic
1154950383 18:21204018-21204040 CAAGCTTTGAACCAGGGGCATGG - Intergenic
1159887027 18:73918670-73918692 CAACCCACAAAGCAGGGAAATGG - Intergenic
1162644765 19:12040685-12040707 AATCCCTTGAACCAGGGAGACGG + Intronic
1163692058 19:18743516-18743538 CCACCCGCAGACCAGGGACAGGG - Intronic
1163706030 19:18813904-18813926 AATCGCTCGAACCAGGGAGACGG - Intergenic
1166735319 19:45080460-45080482 AATCCCTTGAACCAGGGAGACGG - Intronic
926936172 2:18088289-18088311 TAACCCTAGAAGTAGGGACAAGG - Intronic
927811539 2:26183156-26183178 CAACCTTCCAACCAGAGTCAGGG - Intronic
928401873 2:30984884-30984906 CTACACCCAAACCAGGGACAGGG + Intronic
937227281 2:120377203-120377225 AGACCCTCGAGCCAGGGGCAGGG - Intergenic
937733422 2:125261277-125261299 TAACCCTCGACCTGGGGACAAGG - Intergenic
939569777 2:143827097-143827119 CAACCCTCTAAGCAGGGACTTGG - Intergenic
941245745 2:163094361-163094383 AATCCCTCGAACCAGGGAGGTGG - Intergenic
943953912 2:194162123-194162145 CAACCCATGAAACAGGGACAAGG - Intergenic
944176145 2:196831085-196831107 CAACCCTTGAACCAGAGACAAGG - Intergenic
946363913 2:219236737-219236759 TAACCCTTGGACCTGGGACATGG - Exonic
946442310 2:219706969-219706991 CAAGCCAAGAACGAGGGACACGG - Intergenic
948159340 2:235811580-235811602 CCAACCACGAACCAGGGACGGGG - Intronic
1169510458 20:6258560-6258582 CATCCCTGCAACTAGGGACAAGG + Intergenic
1172597522 20:36159912-36159934 CAACCCTAAAACCAGGTACTTGG - Intronic
1172778109 20:37419920-37419942 CAGCTCTGGAACCAGGGACCAGG - Intergenic
1173234748 20:41234488-41234510 CTACCCTCAAATCAGGGAAAAGG + Intronic
1173364381 20:42371723-42371745 CTTCCCTTGAACCAGGGACTGGG - Intronic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1179468996 21:41598046-41598068 CACCCCTCGACTCAGGGTCAGGG + Intergenic
1181510460 22:23386584-23386606 CAACCCTGGAGCCAGGGGCCTGG + Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1185229010 22:49669844-49669866 CAAACCTTGAGCTAGGGACAGGG + Intergenic
1185229027 22:49669996-49670018 CAAACCTTGAGCTAGGGACAGGG + Intergenic
949555484 3:5148808-5148830 CAACCCTTGAACCAGGCAAAAGG - Intronic
953811643 3:46117644-46117666 CAACCCTTGAACCAGGGACAAGG - Intergenic
955576015 3:60363966-60363988 CACCCCTTGACCTAGGGACAAGG - Intronic
961481247 3:127182651-127182673 CAACCCCAGACCCAGGGCCAGGG + Intergenic
961797001 3:129416328-129416350 AATCCCTTGAACCAGGGAGAGGG + Intronic
964711363 3:159674942-159674964 CAACCCCAGCACCAGGGACAAGG + Intronic
967631035 3:191743122-191743144 CAACCCTCAAACCAGGGACAAGG - Intergenic
969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG + Intronic
975634458 4:76432876-76432898 CCACCCTGGAGCCGGGGACAGGG + Intergenic
981710567 4:147705370-147705392 CAACCCAGGAACCTGGGAGATGG - Intergenic
982259488 4:153481931-153481953 AAACCCTTGAACCTGGGAGATGG - Intronic
985674667 5:1224825-1224847 CAACCCTCCACCCATGGACAGGG + Exonic
993260110 5:85647224-85647246 CAACCCTCGAACCAGGAACAAGG - Intergenic
993542574 5:89170894-89170916 AAACCCTTGAACCTGGGAGATGG + Intergenic
996653909 5:125915585-125915607 CAACCCTCAAATCAGGGACACGG + Intergenic
997064954 5:130549066-130549088 CAACCCACGAACCAGGGACAAGG - Intergenic
998107517 5:139477707-139477729 CAACTCTGAAATCAGGGACACGG + Intronic
1002359976 5:178662616-178662638 CAACCTGCGCACCAGGGGCAAGG + Intergenic
1003428836 6:6020530-6020552 CCAGCCTCACACCAGGGACAGGG - Intergenic
1007647184 6:43391962-43391984 TAATCCTCAAACCAGGGACAAGG + Intergenic
1010643135 6:78355029-78355051 AATCCCTTGAACCAGGGAGAAGG + Intergenic
1010892033 6:81325063-81325085 TACCCCTCAAACCAGGTACATGG - Intergenic
1012054204 6:94384288-94384310 AAACCCCAGAACCAGGGAAACGG - Intergenic
1019614537 7:1953145-1953167 CCACCCTGGTCCCAGGGACACGG + Intronic
1021522992 7:21555297-21555319 CAACCCTTGAATCAGGGACAAGG - Intronic
1021949748 7:25763074-25763096 AGACCCTTCAACCAGGGACAGGG + Intergenic
1022041775 7:26588251-26588273 CCACCCTCAAAGGAGGGACAGGG - Intergenic
1028969097 7:96837103-96837125 AATCCCTTGAACCAGGGAGATGG + Intergenic
1030948844 7:115763584-115763606 CAGCCCTTGAGCCAGGGACTGGG - Intergenic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1031214298 7:118870600-118870622 TAATCCTCAAACCAGGGACAAGG + Intergenic
1031552788 7:123135078-123135100 CAACCATCGAACCAGGTATATGG + Intronic
1034590229 7:152132239-152132261 AAACCCTGGCACCAGAGACAGGG + Intergenic
1034914646 7:155026829-155026851 CAATCCTCCATCCAGGAACATGG - Intergenic
1035986072 8:4433410-4433432 CAACCTTTGAACCAGGAATAGGG + Intronic
1046239371 8:111470952-111470974 CCACCTTCAAACCAGGGACAGGG + Intergenic
1047561018 8:125988227-125988249 TAACCCTTGAACCAGCGACAAGG + Intergenic
1047782305 8:128119979-128120001 AATCCCTCGAACCTGGGAGATGG + Intergenic
1048912680 8:139151087-139151109 CAATCCTCTAACCAGGGAAGAGG - Intergenic
1049364696 8:142231496-142231518 CAACCCTCCTGGCAGGGACAGGG + Intronic
1055024927 9:71709425-71709447 CAATCTTCAAACCAGGGACCAGG + Exonic
1057130234 9:92649652-92649674 GCCCCCTGGAACCAGGGACAAGG - Intronic
1060749576 9:126160150-126160172 CAACCCAGGATCCAGGGATAGGG - Intergenic
1061861695 9:133471750-133471772 CAACCCTGCATCCAGGGACACGG - Exonic
1061924125 9:133797666-133797688 CAACCTTGGAGCCAGGGCCAGGG + Intronic
1187438033 X:19290415-19290437 CAACCAACGAAGCAGTGACAAGG - Intergenic
1190063897 X:47227286-47227308 CCCCCCTCAAACCAGGGGCAGGG + Intronic
1196724685 X:118885570-118885592 CAACCCTTGAACCAGGGACAAGG + Intergenic