ID: 1129376854

View in Genome Browser
Species Human (GRCh38)
Location 15:75138971-75138993
Sequence CTGTTTGTGCAAAGGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129376854_1129376859 -2 Left 1129376854 15:75138971-75138993 CCCATGTCCCTTTGCACAAACAG No data
Right 1129376859 15:75138992-75139014 AGCCCCCATTGGCCATCCTTTGG No data
1129376854_1129376860 -1 Left 1129376854 15:75138971-75138993 CCCATGTCCCTTTGCACAAACAG No data
Right 1129376860 15:75138993-75139015 GCCCCCATTGGCCATCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129376854 Original CRISPR CTGTTTGTGCAAAGGGACAT GGG (reversed) Intergenic
No off target data available for this crispr