ID: 1129377482 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:75143234-75143256 |
Sequence | CCTTATGGGCAGTTGGGGCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129377474_1129377482 | -9 | Left | 1129377474 | 15:75143220-75143242 | CCTAGGGCCGACACCCTTATGGG | No data | ||
Right | 1129377482 | 15:75143234-75143256 | CCTTATGGGCAGTTGGGGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129377482 | Original CRISPR | CCTTATGGGCAGTTGGGGCC TGG | Intergenic | ||
No off target data available for this crispr |