ID: 1129377482

View in Genome Browser
Species Human (GRCh38)
Location 15:75143234-75143256
Sequence CCTTATGGGCAGTTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129377474_1129377482 -9 Left 1129377474 15:75143220-75143242 CCTAGGGCCGACACCCTTATGGG No data
Right 1129377482 15:75143234-75143256 CCTTATGGGCAGTTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129377482 Original CRISPR CCTTATGGGCAGTTGGGGCC TGG Intergenic
No off target data available for this crispr