ID: 1129377899

View in Genome Browser
Species Human (GRCh38)
Location 15:75145597-75145619
Sequence CCCTGGGAGCCACTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129377899_1129377903 -8 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377903 15:75145612-75145634 TCCCAGGGCAGTGGACTCTAGGG No data
1129377899_1129377909 3 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377909 15:75145623-75145645 TGGACTCTAGGGGGCTCCCAGGG No data
1129377899_1129377912 16 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377912 15:75145636-75145658 GCTCCCAGGGACAGGCTCCAGGG No data
1129377899_1129377905 -7 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377905 15:75145613-75145635 CCCAGGGCAGTGGACTCTAGGGG No data
1129377899_1129377911 15 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377911 15:75145635-75145657 GGCTCCCAGGGACAGGCTCCAGG No data
1129377899_1129377907 -6 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377907 15:75145614-75145636 CCAGGGCAGTGGACTCTAGGGGG No data
1129377899_1129377908 2 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377908 15:75145622-75145644 GTGGACTCTAGGGGGCTCCCAGG No data
1129377899_1129377910 8 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377910 15:75145628-75145650 TCTAGGGGGCTCCCAGGGACAGG No data
1129377899_1129377902 -9 Left 1129377899 15:75145597-75145619 CCTCATCACAGTGGCTCCCAGGG No data
Right 1129377902 15:75145611-75145633 CTCCCAGGGCAGTGGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129377899 Original CRISPR CCCTGGGAGCCACTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr