ID: 1129379322

View in Genome Browser
Species Human (GRCh38)
Location 15:75155306-75155328
Sequence AGAGAGATCTGAATGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129379317_1129379322 -10 Left 1129379317 15:75155293-75155315 CCGGGCACCTCCAAGAGAGATCT No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data
1129379315_1129379322 2 Left 1129379315 15:75155281-75155303 CCCTGGGGATCACCGGGCACCTC No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data
1129379307_1129379322 23 Left 1129379307 15:75155260-75155282 CCTTGACTCCACCGAGCTCTGCC No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data
1129379311_1129379322 15 Left 1129379311 15:75155268-75155290 CCACCGAGCTCTGCCCTGGGGAT No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data
1129379316_1129379322 1 Left 1129379316 15:75155282-75155304 CCTGGGGATCACCGGGCACCTCC No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data
1129379312_1129379322 12 Left 1129379312 15:75155271-75155293 CCGAGCTCTGCCCTGGGGATCAC No data
Right 1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129379322 Original CRISPR AGAGAGATCTGAATGGCTCT GGG Intergenic
No off target data available for this crispr