ID: 1129382063

View in Genome Browser
Species Human (GRCh38)
Location 15:75174285-75174307
Sequence GCCACCCTTTGCTCCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129382052_1129382063 10 Left 1129382052 15:75174252-75174274 CCAGCCCCCTTGTCACCCCTGCC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382049_1129382063 20 Left 1129382049 15:75174242-75174264 CCAGTGCCACCCAGCCCCCTTGT No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382048_1129382063 21 Left 1129382048 15:75174241-75174263 CCCAGTGCCACCCAGCCCCCTTG No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382054_1129382063 5 Left 1129382054 15:75174257-75174279 CCCCTTGTCACCCCTGCCCTGCA No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382059_1129382063 -7 Left 1129382059 15:75174269-75174291 CCTGCCCTGCAACACTGCCACCC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382050_1129382063 14 Left 1129382050 15:75174248-75174270 CCACCCAGCCCCCTTGTCACCCC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382057_1129382063 -5 Left 1129382057 15:75174267-75174289 CCCCTGCCCTGCAACACTGCCAC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382058_1129382063 -6 Left 1129382058 15:75174268-75174290 CCCTGCCCTGCAACACTGCCACC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382051_1129382063 11 Left 1129382051 15:75174251-75174273 CCCAGCCCCCTTGTCACCCCTGC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382056_1129382063 3 Left 1129382056 15:75174259-75174281 CCTTGTCACCCCTGCCCTGCAAC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382053_1129382063 6 Left 1129382053 15:75174256-75174278 CCCCCTTGTCACCCCTGCCCTGC No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382055_1129382063 4 Left 1129382055 15:75174258-75174280 CCCTTGTCACCCCTGCCCTGCAA No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data
1129382047_1129382063 22 Left 1129382047 15:75174240-75174262 CCCCAGTGCCACCCAGCCCCCTT No data
Right 1129382063 15:75174285-75174307 GCCACCCTTTGCTCCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129382063 Original CRISPR GCCACCCTTTGCTCCCTTGA GGG Intergenic
No off target data available for this crispr