ID: 1129384420

View in Genome Browser
Species Human (GRCh38)
Location 15:75188129-75188151
Sequence CACTCTATGCTGAAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129384420_1129384432 21 Left 1129384420 15:75188129-75188151 CCCAGCCCCTTCAGCATAGAGTG No data
Right 1129384432 15:75188173-75188195 CACCCTACCCTCCCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129384420 Original CRISPR CACTCTATGCTGAAGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr