ID: 1129384468

View in Genome Browser
Species Human (GRCh38)
Location 15:75188336-75188358
Sequence CAGCTCCCAGTGCTGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129384468_1129384479 28 Left 1129384468 15:75188336-75188358 CCCAGCCACAGCACTGGGAGCTG No data
Right 1129384479 15:75188387-75188409 AGCACAGGGCCAGCCAGTCATGG No data
1129384468_1129384474 13 Left 1129384468 15:75188336-75188358 CCCAGCCACAGCACTGGGAGCTG No data
Right 1129384474 15:75188372-75188394 CCCCACTGAACCTGCAGCACAGG No data
1129384468_1129384476 14 Left 1129384468 15:75188336-75188358 CCCAGCCACAGCACTGGGAGCTG No data
Right 1129384476 15:75188373-75188395 CCCACTGAACCTGCAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129384468 Original CRISPR CAGCTCCCAGTGCTGTGGCT GGG (reversed) Intergenic
No off target data available for this crispr