ID: 1129386197

View in Genome Browser
Species Human (GRCh38)
Location 15:75197414-75197436
Sequence AGCCATTGGAGGCTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129386197 Original CRISPR AGCCATTGGAGGCTTGGTGC TGG (reversed) Intronic
900533118 1:3164506-3164528 AGCCAAGGGAGGCCGGGTGCAGG - Intronic
900576198 1:3383655-3383677 AGCCATTTCGGGCCTGGTGCTGG - Intronic
901756402 1:11444055-11444077 AGCCACTGGAGGCTTCTGGCTGG - Intergenic
902269025 1:15289681-15289703 TGCCATTGGTGGCTTGGGGGTGG + Intronic
902960957 1:19962516-19962538 AGACATTGGGGGCTTGCTGGAGG + Intergenic
903037191 1:20500525-20500547 TGCCATTGGAGGCATGGGTCTGG + Exonic
903235990 1:21951157-21951179 AGGCATTGGTGGATTGGTCCAGG + Intergenic
905471327 1:38194237-38194259 AGCTCTTGGAGGCTTGGATCGGG + Intergenic
906706127 1:47896240-47896262 AGCCAGCGGAGGCTTGGCCCAGG + Intronic
906707515 1:47905537-47905559 AGCCATGGGAGGCTGGGGACAGG - Intronic
911094303 1:94043248-94043270 AGGCAGGGGAGGCTTGGAGCAGG - Intronic
913249699 1:116902584-116902606 AGCCATAAGCGGCTTGGTGCCGG + Intergenic
913941769 1:125116073-125116095 GGCCATTTGAGGATAGGTGCAGG - Intergenic
914973332 1:152331938-152331960 AGGAATTGGAAGCTTGGTGAGGG - Intergenic
919443343 1:197667686-197667708 TGGAATTGGGGGCTTGGTGCAGG - Intronic
922821972 1:228490838-228490860 AGCCATTGGAGTTCTGGTGTGGG + Intronic
924543235 1:245000935-245000957 TGTCAGTGGAGGCTTGGTGGAGG + Intronic
1066782468 10:38967617-38967639 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1066950926 10:42115449-42115471 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1066954649 10:42153009-42153031 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1067291999 10:44950413-44950435 GGCTTTTGGAGGCTGGGTGCTGG - Intergenic
1067788226 10:49268136-49268158 AGCCATTGTGGTCTTGGTGGGGG + Intergenic
1068178810 10:53495540-53495562 AGTCATTGGTGGCTTGATGGGGG + Intergenic
1068199943 10:53770596-53770618 AGCCATTGGAGACTTTAAGCAGG + Intergenic
1068685899 10:59869735-59869757 AGCCTTTGGAGGGTTTGAGCAGG - Intronic
1069545110 10:69322069-69322091 AGCCATTAGGAGCTTGGAGCAGG + Intronic
1070650612 10:78232972-78232994 AGTCACTGCAGGCTGGGTGCAGG - Intergenic
1076510600 10:131011478-131011500 GGCCAGTAGAAGCTTGGTGCTGG - Intergenic
1078826776 11:14937478-14937500 AGGCATTGCAGGCTTCGAGCTGG - Intronic
1079281489 11:19090838-19090860 ATCCACTGGAGGCTTTGAGCAGG - Intergenic
1080433314 11:32217843-32217865 AGTCATTGGAGGCAGGATGCTGG + Intergenic
1082175923 11:49059312-49059334 AGCCATTGAAGGTTCGGTCCAGG + Intergenic
1083169824 11:60916769-60916791 AGCCACTGGAGAGTTGGGGCTGG + Intronic
1083329418 11:61890748-61890770 TGCCATTAGAGGCTGGGGGCTGG - Intronic
1083558435 11:63651771-63651793 AGCCATTGGTGGGGTGGAGCAGG - Intronic
1084804851 11:71571652-71571674 AGCCATGGGGGGCTGGGGGCCGG + Intergenic
1084805602 11:71576871-71576893 AGCCATGGGGGGCTGGGGGCGGG - Intergenic
1085389084 11:76173074-76173096 AGCCACTGCAGGTTTGGAGCAGG - Intergenic
1085520742 11:77137726-77137748 AGGCCTTGGAGGCCTGGTGTGGG - Intronic
1085530238 11:77188090-77188112 AGCCTTTGGACTCTTGGTTCAGG - Intronic
1085769395 11:79311414-79311436 AGCCATTGGAGGCTAAGTGCTGG + Intronic
1086038110 11:82441513-82441535 AGCCACTGGGGGCTTGGTGGAGG + Intergenic
1086170755 11:83833730-83833752 GGCCAGTGGAGCCTTTGTGCAGG + Exonic
1086689824 11:89776760-89776782 AGCCATTGAAGATTTGGTTCAGG - Intergenic
1086716031 11:90063196-90063218 AGCCATTGAAGATTTGGTTCAGG + Intergenic
1086865788 11:91978560-91978582 AGACATTGGAGTCTTGCTGAGGG - Intergenic
1089299177 11:117488180-117488202 GGTCCTTGGAGGCTGGGTGCAGG - Intronic
1089323873 11:117644196-117644218 AGCCTTTCGAGACTTGGTGGGGG - Intronic
1090646888 11:128773524-128773546 ATCCATTGGAGGCTTTCTTCTGG + Intronic
1090985827 11:131765237-131765259 AGCCATTGGAGGGTTGAAGAAGG - Intronic
1091327594 11:134702934-134702956 AGGCATGGGAGCCTTGGTGAAGG - Intergenic
1093305277 12:17509267-17509289 AGCCACTGGAGGTTTGAAGCAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1099862551 12:88238625-88238647 TGCTATTGCAGGCATGGTGCTGG + Intergenic
1102159419 12:110756508-110756530 AGCCATTGGACCTTTGGAGCAGG - Intergenic
1104676857 12:130716991-130717013 GGCCACTGGAGGCTTGGGGTGGG - Intergenic
1104878790 12:132054905-132054927 AGCCTTTGGAGGATTTATGCAGG + Intronic
1107964800 13:45588874-45588896 AGCCATTGGATCCTGGATGCTGG + Intronic
1111800215 13:92971869-92971891 ATCCACTCGAGGCTCGGTGCTGG + Intergenic
1113756143 13:112812416-112812438 AGCCGTAGGAGGTTTGGTGAGGG + Intronic
1113866818 13:113531930-113531952 AGCCGTTAGGGGCTTGGTCCTGG + Intronic
1115766637 14:36629659-36629681 TACCATTGGAGGCTTGGTGAAGG - Intergenic
1116671285 14:47846145-47846167 AGCCACTGGAGCCATGGTGATGG - Intergenic
1118460909 14:65986160-65986182 AGCCATTGGGGGTTTGGTAAAGG + Intronic
1119889100 14:78169414-78169436 AGCTATTAGTGGATTGGTGCTGG + Intergenic
1122689250 14:103523719-103523741 AGCCATTGCTGGCTTTGAGCTGG + Intergenic
1125761253 15:42097111-42097133 AGCCCTTGGAGGGTTGGAGTGGG - Intergenic
1128290756 15:66476703-66476725 AGCCATGGCAGGCTCTGTGCAGG + Intronic
1128354462 15:66915182-66915204 AGTCATTGGAGGCTTTAAGCAGG - Intergenic
1128525592 15:68410242-68410264 AACCAGTGGAGGCCTGGGGCAGG - Intronic
1128977390 15:72163614-72163636 AGACATTGGAGGCTTCCTGGAGG + Exonic
1129386197 15:75197414-75197436 AGCCATTGGAGGCTTGGTGCTGG - Intronic
1129570362 15:76676262-76676284 AGCCAGTGCAGGCTGGGTGAAGG - Intronic
1132028647 15:98422651-98422673 AGCCTTTGCAGGCCTGGGGCTGG - Intergenic
1132364461 15:101247096-101247118 AGCCACTGGAGGGTTTATGCAGG - Intronic
1132468487 16:88960-88982 TGTCATTGGAGGCTGGCTGCTGG - Intronic
1136696789 16:32088036-32088058 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1136797290 16:33031326-33031348 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1136939097 16:34503548-34503570 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1136960723 16:34845013-34845035 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1137084687 16:36104747-36104769 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1137219312 16:46431043-46431065 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1141641339 16:85343375-85343397 TGCCCTTGGAGGCTGGGTGAAGG + Intergenic
1144316084 17:14062904-14062926 TTCCATTGGAGGCTTTGTGAAGG - Intergenic
1145689887 17:26728956-26728978 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1145693744 17:26771199-26771221 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1148819267 17:50351099-50351121 AGCCACTGGAGGTTTGGAGCAGG + Intronic
1150866645 17:68857518-68857540 AGTGATTGAAGTCTTGGTGCTGG - Intergenic
1151418400 17:73981801-73981823 GGCCATTGGATACATGGTGCAGG + Intergenic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1152551857 17:81034322-81034344 AGCGCTTGGGGGCTTGGGGCCGG - Intergenic
1203191090 17_KI270729v1_random:190357-190379 GGCCATTGGAGGGTAGGTGCAGG - Intergenic
1154350600 18:13580189-13580211 AGCCACTGAAGGCTTTGAGCAGG - Intronic
1154516105 18:15167398-15167420 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1159868661 18:73735702-73735724 AGCCACTGGAGGTTTTGAGCAGG + Intergenic
1162868890 19:13570666-13570688 AGCCATAGGAGGTTTGAAGCAGG - Intronic
1164544790 19:29151370-29151392 AGCCACTGGAGGCTTGGTTAGGG - Intergenic
1165976688 19:39682228-39682250 AGCCCATGGAGGGTGGGTGCTGG - Intergenic
1167615793 19:50532372-50532394 AGCCATGGGAGGCTGGGAGTGGG - Intronic
1202669336 1_KI270709v1_random:36795-36817 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
926126829 2:10277235-10277257 GGGCTTTGGAGGCTTGGAGCAGG + Intergenic
927147321 2:20174758-20174780 AGCCTTTAGAGGCTTTGAGCAGG + Intergenic
932205077 2:69873182-69873204 CACCATTTGAGGCTTGGTTCAGG - Intronic
934251958 2:90363052-90363074 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
934257481 2:91439904-91439926 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
934331109 2:92070462-92070484 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
938134999 2:128749686-128749708 ACCAATGGGAGGCTGGGTGCGGG - Intergenic
938516440 2:132012414-132012436 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
938742762 2:134248444-134248466 AGCCCCTGGAGGCTTTATGCAGG + Intronic
939590608 2:144059636-144059658 AGCCATTGGAGGGTTGGATAGGG - Intronic
940801285 2:158136006-158136028 ACCGAATGGAGGCTTGGGGCAGG + Exonic
947496627 2:230642529-230642551 ATCCACTGGAGGCTGGCTGCAGG + Intergenic
1168816814 20:743400-743422 AGCCATTGGAGGGTTTAGGCAGG - Intergenic
1169331157 20:4717474-4717496 AGCCACTGAAGGCTTAGGGCAGG - Intergenic
1172636665 20:36414646-36414668 AGACATGAGAGGTTTGGTGCTGG + Intronic
1172987712 20:39006250-39006272 AGCTATTGAATGCTTGGTGGTGG + Exonic
1173821646 20:46023458-46023480 GGCCATGTGAGGCTTGGAGCAGG - Intronic
1174453870 20:50636303-50636325 AGCAAATGGAGGCTGGGTGCTGG + Intronic
1175250751 20:57609015-57609037 AGCCATGGGGGGCTTTGAGCAGG - Intronic
1175309092 20:57999070-57999092 AGAAGTTGGAGGCTTGGTCCTGG + Intergenic
1175529540 20:59664897-59664919 ATCCATTGCGGGCTGGGTGCAGG + Intronic
1179416388 21:41201952-41201974 AACCACTGGAGGCCTGGTGTTGG + Intronic
1179984598 21:44913542-44913564 AGCCCTGGGGGGCTTGGAGCTGG + Intronic
1180088785 21:45523519-45523541 GGCCCATGGGGGCTTGGTGCAGG - Intronic
1181764576 22:25082006-25082028 AGCTATGGAAGGCTTGATGCAGG + Intronic
1184377844 22:44125730-44125752 AGCCATTGGAGGTTTTGGGTAGG + Intronic
1184453178 22:44594862-44594884 AGCCACTGGAAGGTTGGAGCAGG + Intergenic
1184551205 22:45205104-45205126 AGGCATGGGTGGCTTGGAGCCGG - Intronic
1184787729 22:46679998-46680020 GGGCATTGGAGGCTGGGAGCAGG + Intergenic
1203325306 22_KI270738v1_random:8536-8558 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
950151168 3:10688670-10688692 GGCCATAGGAGGCCTGGCGCAGG - Intronic
950553410 3:13681227-13681249 AGCAAGTGGAAGCTTTGTGCAGG - Intergenic
950797695 3:15523617-15523639 AGCCACTGGAAGCTGGCTGCTGG - Intergenic
954600315 3:51862588-51862610 AGCCAGTGGTGGTTTGGGGCTGG + Intronic
956967029 3:74473953-74473975 AACCATTGGAGGTTTTGTCCAGG + Intronic
962985917 3:140535801-140535823 AGGCATTGGAGGCTTGAGGTTGG - Intronic
968532964 4:1104916-1104938 AGGCATTTGAGGATGGGTGCTGG + Intronic
968621530 4:1605434-1605456 AGCCCCTGGAAGCTGGGTGCAGG - Intergenic
969584287 4:8083136-8083158 AGCCAACAGAGGCTTGGAGCCGG - Intronic
975682466 4:76890167-76890189 AGCCATTGAAGGTTTAATGCAGG - Intergenic
977979986 4:103309915-103309937 AGGCATTGGAGGGTTTGAGCAGG + Intergenic
978540143 4:109807803-109807825 AGCCATTGGAGGCTAGTTGGTGG + Intergenic
980658385 4:135820997-135821019 AGCCATTGGAGGTTTTCTGGGGG + Intergenic
980667205 4:135955470-135955492 AGCAATTGGAGGCTCTGTGATGG - Intergenic
982513736 4:156318081-156318103 AGCCAATGGAGGCCTGTTGCTGG + Intergenic
987155756 5:15088291-15088313 AGCCATTTGAGGATTTATGCAGG - Intergenic
987580713 5:19787771-19787793 ATTCATTGGACACTTGGTGCTGG - Intronic
994236188 5:97365724-97365746 AGCTGTTGGTGGCTTGGTCCAGG + Intergenic
994278036 5:97863090-97863112 AGCCATTTCAGGCTTGTTTCAGG - Intergenic
995052799 5:107725361-107725383 AGCCATTGAAGTCTTTGTACAGG + Intergenic
998068526 5:139178380-139178402 AGCCTTTGGAGAGTTGGTGGTGG - Intronic
998139244 5:139690563-139690585 GGCCATGGGAGGCTTGGGGGTGG + Intergenic
998261114 5:140632576-140632598 AGGCAGCGGAGGCATGGTGCCGG + Exonic
999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG + Intergenic
1003521099 6:6859242-6859264 AGGCCTTGGAGACTTGGTCCTGG + Intergenic
1004155679 6:13165918-13165940 AGCCACTGCAGGCTTTGAGCAGG - Intronic
1006058171 6:31400868-31400890 AGACCTGGGAGGCTTGGTGGGGG + Intronic
1006070555 6:31495080-31495102 AGACCTGGGAGGCTTGGTGGGGG + Intronic
1006186459 6:32184186-32184208 AGCAGTTGGAGCCTGGGTGCTGG - Exonic
1006239024 6:32661398-32661420 TGGCGTTGGAGGCTTCGTGCTGG - Exonic
1006248095 6:32757824-32757846 TGGCATTGGAGGCTTCGTGCTGG - Intronic
1006826025 6:36937068-36937090 TGCCATTGGTGGCTTGGAGGAGG - Intergenic
1008520819 6:52361513-52361535 ATCTATTGGAGGCAGGGTGCGGG - Intronic
1010036306 6:71329378-71329400 AGCCTTTGGAGGCTTTAAGCAGG + Intergenic
1010927851 6:81765227-81765249 AGCTATTGAAGGCTTTGAGCAGG + Intergenic
1011443137 6:87408388-87408410 AGTAATTGGAGGGTGGGTGCAGG + Intronic
1011695875 6:89912216-89912238 AGGCACTGGATGCTGGGTGCTGG + Intergenic
1014571069 6:123008733-123008755 AGGCATTGGAAGGTTGGAGCAGG - Intronic
1017155691 6:151320781-151320803 AGCCATTGGAGGCTTGAGGCAGG - Intronic
1018458777 6:163977532-163977554 AGTCATTGGTAGCTTGGTGGGGG + Intergenic
1018780205 6:167056899-167056921 AGCCTTGGGAGGCTTCATGCAGG - Intergenic
1019593556 7:1847811-1847833 AGCAAGTGGAGGCCTGGAGCCGG - Exonic
1022111379 7:27234555-27234577 AGCCATTCCAGGCTGGGTGCAGG + Intergenic
1022687457 7:32610088-32610110 AGCAATGTGAGGCTGGGTGCAGG + Intergenic
1024806853 7:53151873-53151895 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1025478154 7:60953379-60953401 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1025553867 7:62279132-62279154 GGCCATTTGAGGGTAGGTGCAGG + Intergenic
1025560912 7:62374142-62374164 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1028037694 7:86005123-86005145 AGCCATGGTAGGCTGAGTGCTGG - Intergenic
1029403709 7:100360514-100360536 AGCTGTAGGAAGCTTGGTGCTGG + Intronic
1029423630 7:100484016-100484038 AACCTGGGGAGGCTTGGTGCAGG + Intronic
1029589633 7:101498841-101498863 AGGCGAGGGAGGCTTGGTGCTGG + Intronic
1034075309 7:148225709-148225731 AGACACTGGTGGCTTGGTCCAGG + Intronic
1038239450 8:25795222-25795244 TGCCATTGGAGGCTGGGTCTGGG - Intergenic
1039084174 8:33763385-33763407 AGGCAGGGGATGCTTGGTGCTGG + Intergenic
1040497722 8:47981404-47981426 ATCCATTAAAGGCTGGGTGCAGG - Intergenic
1045016581 8:98006003-98006025 AGACACTGGAGGCCTGGTGCAGG - Intronic
1046617250 8:116491011-116491033 AGCCAAAGGAGGCAGGGTGCAGG + Intergenic
1048204616 8:132405383-132405405 TGCCACTGGTGGCTGGGTGCTGG - Intronic
1050356951 9:4792778-4792800 AGCCAATGGAGGCGCGGCGCGGG + Intergenic
1053945730 9:43308548-43308570 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1055689180 9:78811099-78811121 AGCCATTGGAGGCGTAGAGTGGG + Intergenic
1058848677 9:108988556-108988578 AGCCATTGGAGGTTTTGAGTAGG - Intronic
1059086381 9:111307183-111307205 AGCCATTTTATGCTTGGTTCAGG - Intergenic
1060179999 9:121527433-121527455 AGCCAGTGGGGGCTGGGGGCTGG + Intergenic
1061726320 9:132583888-132583910 AGCCATTGGGGGGTGGGTGCAGG - Intronic
1203588865 Un_KI270747v1:37128-37150 GGCCATTTGAGGGTAGGTGCAGG - Intergenic
1185876160 X:3703959-3703981 AGCCATTAGAGGCCGGGTGTGGG - Intronic
1188482075 X:30646559-30646581 AGCCACTGGAGGCTTAGAGGTGG + Intergenic
1189232393 X:39462698-39462720 AGCCATTTGAAGCTTGAAGCAGG + Intergenic
1189597417 X:42584165-42584187 AGACAATGGAGGCTTGGAGCAGG - Intergenic
1189677600 X:43477805-43477827 AGGTATTGGAGACTTGGTTCAGG - Intergenic
1191784621 X:64903985-64904007 AGCATTTGGAGGTTTGGTGCAGG - Intergenic
1193085651 X:77446487-77446509 GGCCATTGGAAGCCTGGTGGGGG - Intergenic