ID: 1129387011

View in Genome Browser
Species Human (GRCh38)
Location 15:75201868-75201890
Sequence GCGCCGTCTGCGGTCCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129387011_1129387024 18 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387024 15:75201909-75201931 GCAGCTAGGAGGGTTGCTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 164
1129387011_1129387023 17 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387023 15:75201908-75201930 GGCAGCTAGGAGGGTTGCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 146
1129387011_1129387025 23 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387025 15:75201914-75201936 TAGGAGGGTTGCTCCGGGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 283
1129387011_1129387020 4 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387020 15:75201895-75201917 CGGCGGCGCGAACGGCAGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 65
1129387011_1129387017 -4 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387017 15:75201887-75201909 GCGCCCAGCGGCGGCGCGAACGG 0: 1
1: 0
2: 0
3: 6
4: 84
1129387011_1129387022 8 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387022 15:75201899-75201921 GGCGCGAACGGCAGCTAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 43
1129387011_1129387021 7 Left 1129387011 15:75201868-75201890 CCGCCCGGGACCGCAGACGGCGC 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1129387021 15:75201898-75201920 CGGCGCGAACGGCAGCTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129387011 Original CRISPR GCGCCGTCTGCGGTCCCGGG CGG (reversed) Intronic
900183968 1:1324524-1324546 GCTCCGTATGCGGCTCCGGGCGG - Intronic
900287556 1:1908888-1908910 GCGCCGGCTGCGGCCCCGCAGGG - Intergenic
900694794 1:4002972-4002994 GCTCCCTCTGCGGGCCCTGGGGG - Intergenic
902916751 1:19644299-19644321 GCGCTGTCTGCGGCCCCGGGCGG - Intronic
905803734 1:40861779-40861801 GCGCCGGCTGCGGGCCCGGGGGG + Exonic
906568053 1:46814375-46814397 GCTCCTTCTGCTGTCCTGGGAGG - Intronic
915247738 1:154568255-154568277 GTGCTCTCTGCAGTCCCGGGGGG - Intronic
921325284 1:213982665-213982687 GCCCCTCCCGCGGTCCCGGGAGG + Intergenic
924172499 1:241356923-241356945 GCGGCGTCTCCCCTCCCGGGCGG + Exonic
924289696 1:242524641-242524663 CCGGCGGCTGCGGTCCCGAGCGG + Intronic
1063022298 10:2141610-2141632 GTGCCCTCTGAGGTCACGGGTGG + Intergenic
1076372203 10:129963208-129963230 CAGCCCTCGGCGGTCCCGGGCGG + Intronic
1076775225 10:132691920-132691942 GCGGGGTGTGCGGTCGCGGGAGG + Intronic
1077402524 11:2366248-2366270 GCCCCGTCTGCCGTGCCTGGAGG - Intergenic
1081528519 11:43942875-43942897 CCGGCGTCTGCGGGGCCGGGCGG - Exonic
1081978114 11:47248688-47248710 GCGCAGACTCCGGGCCCGGGTGG + Exonic
1083439171 11:62664904-62664926 GCGGCGTCTGAGGCACCGGGTGG - Exonic
1084146159 11:67266462-67266484 GCCCCGACTGCAGTCCCGGCGGG + Exonic
1084522845 11:69675109-69675131 CCGCCGGCTGCGGCCCAGGGCGG - Intronic
1103649698 12:122422811-122422833 GCGCCCACCGCGGCCCCGGGAGG + Intergenic
1104720486 12:131042640-131042662 GCTCCGTGTTCGGTCCCGGTGGG + Intronic
1108403955 13:50081508-50081530 TCCCCGGCTCCGGTCCCGGGCGG + Intergenic
1116849472 14:49893502-49893524 GCGCAGTCTCAGGGCCCGGGTGG + Exonic
1121273420 14:92652292-92652314 GGGCCGTCTGAGGTCCCTTGGGG - Exonic
1123018237 14:105385607-105385629 GTGCCCTCGGCGGTCCCTGGAGG + Intronic
1129387011 15:75201868-75201890 GCGCCGTCTGCGGTCCCGGGCGG - Intronic
1132545979 16:533652-533674 GCCCTGTCTGCGGTCCTGGCTGG + Intronic
1133058133 16:3157759-3157781 GTCCCGTCTGCGGTCCCTTGTGG + Intergenic
1139489587 16:67279284-67279306 GCGCGGTCTGCGGGGCCCGGGGG + Exonic
1142377167 16:89712057-89712079 GCGCCGGCTGCGGCTCCAGGAGG - Exonic
1143482979 17:7238077-7238099 GCGGCGTGTGCGGTCTCGGAGGG - Intronic
1146057694 17:29589423-29589445 GCGCGGGCGGCGGGCCCGGGCGG + Exonic
1147987574 17:44315325-44315347 GCGACGCCGGCGGGCCCGGGGGG + Intronic
1150069764 17:62140544-62140566 GTGGCGTCTGCGGCCCCAGGAGG - Intergenic
1152728706 17:81959845-81959867 GGGACGGCGGCGGTCCCGGGAGG + Intronic
1154255437 18:12777591-12777613 GCGCCGTCCGGGCTCCCGAGCGG + Intergenic
1157529328 18:48408766-48408788 GCGGCGCCTGCGGGCCCGAGCGG - Intronic
1160365298 18:78319412-78319434 GTGTCGTCTGCGGTCCCCGTGGG - Intergenic
1160729161 19:632907-632929 GTGGCGTCTGCGGCCCCAGGAGG - Exonic
1160858977 19:1229707-1229729 GCGCGGGCTGCGGGGCCGGGCGG + Exonic
1160902123 19:1433887-1433909 GCTTCCTCTGCCGTCCCGGGCGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161591381 19:5130770-5130792 GTGCCTTCTGGGGTCACGGGAGG - Intronic
1161766711 19:6212588-6212610 GGGCCTTCTGAGGTCCAGGGTGG + Intergenic
1162013169 19:7830249-7830271 GCGGCGGCCGCGGTCCCGGGGGG + Intronic
1162470954 19:10871745-10871767 GCGGGGTCGGCGGTCCCGGGCGG + Exonic
1165759984 19:38315495-38315517 TGGCCCTCTGCGCTCCCGGGGGG + Intronic
1168347787 19:55659321-55659343 GCGTCGTCGCCTGTCCCGGGAGG - Exonic
926268130 2:11344495-11344517 CCGCCCTCTGGGGCCCCGGGAGG + Exonic
932236378 2:70124202-70124224 GCGCCTTCCGCGGTCGCTGGGGG + Intergenic
933782944 2:85814382-85814404 GCGCCCTCTGCTGTCCAGGCTGG + Intergenic
938017818 2:127882621-127882643 TCTCCGTCTGCGGTCCAGGCTGG + Intronic
942454476 2:176128921-176128943 GGGCCGGCTGCGGTTCCCGGAGG - Intergenic
948633690 2:239319454-239319476 GCGCCTTGCTCGGTCCCGGGAGG - Intronic
1176952771 21:15065365-15065387 GCGCCTGCAGCGGTCGCGGGCGG - Intergenic
1181299144 22:21867263-21867285 GCGTCCGCTGCGGCCCCGGGCGG + Intronic
1182275757 22:29187812-29187834 GTGCAGTCAGCGGTCCTGGGTGG - Intergenic
1183586402 22:38755601-38755623 GCGCGGGCCGCGGACCCGGGTGG + Intronic
952416814 3:33097095-33097117 GCGCCGACTGCAGAGCCGGGAGG - Exonic
953908950 3:46882370-46882392 GCCCCGTCCGCGGCCCCGGGGGG - Intronic
966696240 3:182793416-182793438 GCGCCGGGGGCGGTCCCGGGTGG + Intergenic
966982688 3:185152893-185152915 GAGCCGGCTGCGGACGCGGGAGG + Exonic
968035413 3:195543903-195543925 GCGGCCTCTGCGGGCCCAGGAGG - Intergenic
968485648 4:859776-859798 GCGCCATCGGAGGTCCCAGGAGG - Intronic
968884892 4:3323098-3323120 GCGCAGTCTGCTGTCCAGGGTGG + Intronic
972751188 4:41990711-41990733 GCTCCGTCTGCGATGCAGGGCGG + Exonic
973894266 4:55396268-55396290 GCCCCGGCTGCGGTCCGGGCCGG + Exonic
992680921 5:79152337-79152359 GCCCCTTCTGCGGCCCCGGGAGG + Intronic
1001928718 5:175658076-175658098 GCGCCGGCTGCGCTCCGGGCAGG - Exonic
1005826313 6:29633248-29633270 GCGCTGTGGGCGGTCCAGGGCGG - Intronic
1006230817 6:32584665-32584687 GCGCGGGCTGCGGTGCTGGGCGG - Intronic
1006316782 6:33296150-33296172 CCGCAATCTCCGGTCCCGGGTGG - Exonic
1012998330 6:105994873-105994895 GCGCCGTCCCCGGACCCGGTCGG - Intergenic
1013637494 6:112043181-112043203 GCGCCCTCTGCTGGCCCGGAGGG + Intergenic
1018862406 6:167720605-167720627 GCCCCGGGTGCGGTCCCAGGAGG - Intergenic
1019350901 7:553515-553537 GTGCCGTCTCCGGACCCTGGAGG - Intronic
1029649682 7:101882808-101882830 GCGCCCTCTGGGGTCACTGGAGG + Intronic
1045564399 8:103298917-103298939 GAGCCGTCTCAGGTCCCTGGGGG + Exonic
1049610786 8:143553835-143553857 GCGCCGTCTGCGGGCAGGAGGGG - Intronic
1050091030 9:2016539-2016561 GCGGCGGCTGCGGGCCCGGGAGG + Intronic
1050325052 9:4490497-4490519 GCGCGGTGCGCGATCCCGGGTGG + Exonic
1057600086 9:96450251-96450273 GCGACCACTGCGGGCCCGGGAGG - Exonic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic