ID: 1129387275

View in Genome Browser
Species Human (GRCh38)
Location 15:75202808-75202830
Sequence CATCCAGCAGGCTGACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 170}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129387275_1129387281 5 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387281 15:75202836-75202858 GCGTCTCGGCGCCGCCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1129387275_1129387279 1 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387279 15:75202832-75202854 ACGTGCGTCTCGGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 1
4: 30
1129387275_1129387284 12 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387284 15:75202843-75202865 GGCGCCGCCGGGAGGGGCTTGGG 0: 1
1: 0
2: 2
3: 34
4: 227
1129387275_1129387285 13 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387285 15:75202844-75202866 GCGCCGCCGGGAGGGGCTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 215
1129387275_1129387288 21 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387288 15:75202852-75202874 GGGAGGGGCTTGGGGACACCCGG 0: 1
1: 1
2: 2
3: 71
4: 532
1129387275_1129387283 11 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG 0: 1
1: 0
2: 1
3: 36
4: 355
1129387275_1129387278 0 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387278 15:75202831-75202853 CACGTGCGTCTCGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1129387275_1129387277 -9 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387277 15:75202822-75202844 TGCTGGATGCACGTGCGTCTCGG 0: 1
1: 0
2: 0
3: 3
4: 67
1129387275_1129387280 4 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387280 15:75202835-75202857 TGCGTCTCGGCGCCGCCGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 61
1129387275_1129387282 6 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387282 15:75202837-75202859 CGTCTCGGCGCCGCCGGGAGGGG 0: 1
1: 1
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129387275 Original CRISPR CATCCAGCAGGCTGACACAC AGG (reversed) Intronic