ID: 1129387276

View in Genome Browser
Species Human (GRCh38)
Location 15:75202820-75202842
Sequence GAGACGCACGTGCATCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129387276_1129387288 9 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387288 15:75202852-75202874 GGGAGGGGCTTGGGGACACCCGG 0: 1
1: 1
2: 2
3: 71
4: 532
1129387276_1129387291 26 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387291 15:75202869-75202891 ACCCGGAAGCCCGCCAGGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1129387276_1129387290 25 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387290 15:75202868-75202890 CACCCGGAAGCCCGCCAGGTCGG 0: 1
1: 0
2: 1
3: 6
4: 93
1129387276_1129387281 -7 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387281 15:75202836-75202858 GCGTCTCGGCGCCGCCGGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1129387276_1129387283 -1 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387283 15:75202842-75202864 CGGCGCCGCCGGGAGGGGCTTGG 0: 1
1: 0
2: 1
3: 36
4: 355
1129387276_1129387289 21 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387289 15:75202864-75202886 GGGACACCCGGAAGCCCGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 111
1129387276_1129387282 -6 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387282 15:75202837-75202859 CGTCTCGGCGCCGCCGGGAGGGG 0: 1
1: 1
2: 0
3: 4
4: 81
1129387276_1129387284 0 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387284 15:75202843-75202865 GGCGCCGCCGGGAGGGGCTTGGG 0: 1
1: 0
2: 2
3: 34
4: 227
1129387276_1129387280 -8 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387280 15:75202835-75202857 TGCGTCTCGGCGCCGCCGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 61
1129387276_1129387285 1 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387285 15:75202844-75202866 GCGCCGCCGGGAGGGGCTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129387276 Original CRISPR GAGACGCACGTGCATCCAGC AGG (reversed) Intronic