ID: 1129387278

View in Genome Browser
Species Human (GRCh38)
Location 15:75202831-75202853
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129387275_1129387278 0 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387278 15:75202831-75202853 CACGTGCGTCTCGGCGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type