ID: 1129387282

View in Genome Browser
Species Human (GRCh38)
Location 15:75202837-75202859
Sequence CGTCTCGGCGCCGCCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129387275_1129387282 6 Left 1129387275 15:75202808-75202830 CCTGTGTGTCAGCCTGCTGGATG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1129387282 15:75202837-75202859 CGTCTCGGCGCCGCCGGGAGGGG 0: 1
1: 1
2: 0
3: 4
4: 81
1129387276_1129387282 -6 Left 1129387276 15:75202820-75202842 CCTGCTGGATGCACGTGCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1129387282 15:75202837-75202859 CGTCTCGGCGCCGCCGGGAGGGG 0: 1
1: 1
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129387282 Original CRISPR CGTCTCGGCGCCGCCGGGAG GGG Intronic