ID: 1129390087

View in Genome Browser
Species Human (GRCh38)
Location 15:75216037-75216059
Sequence CTCCAGAAGGGGACCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129390087_1129390104 7 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390104 15:75216067-75216089 CCATAGATCTCGGTGGGGTGGGG No data
1129390087_1129390101 5 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390101 15:75216065-75216087 CACCATAGATCTCGGTGGGGTGG No data
1129390087_1129390102 6 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390102 15:75216066-75216088 ACCATAGATCTCGGTGGGGTGGG No data
1129390087_1129390099 1 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390099 15:75216061-75216083 CTGGCACCATAGATCTCGGTGGG No data
1129390087_1129390100 2 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390100 15:75216062-75216084 TGGCACCATAGATCTCGGTGGGG No data
1129390087_1129390098 0 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390098 15:75216060-75216082 CCTGGCACCATAGATCTCGGTGG No data
1129390087_1129390096 -3 Left 1129390087 15:75216037-75216059 CCCCCCAGGGTCCCCTTCTGGAG No data
Right 1129390096 15:75216057-75216079 GAGCCTGGCACCATAGATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129390087 Original CRISPR CTCCAGAAGGGGACCCTGGG GGG (reversed) Intergenic
No off target data available for this crispr