ID: 1129393691

View in Genome Browser
Species Human (GRCh38)
Location 15:75233208-75233230
Sequence GGCTCCAGGGACCACGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129393691_1129393700 3 Left 1129393691 15:75233208-75233230 CCTTCCCCGTGGTCCCTGGAGCC No data
Right 1129393700 15:75233234-75233256 GTCAGCGATGAGGAGGCTTCTGG No data
1129393691_1129393698 -4 Left 1129393691 15:75233208-75233230 CCTTCCCCGTGGTCCCTGGAGCC No data
Right 1129393698 15:75233227-75233249 AGCCAATGTCAGCGATGAGGAGG No data
1129393691_1129393703 30 Left 1129393691 15:75233208-75233230 CCTTCCCCGTGGTCCCTGGAGCC No data
Right 1129393703 15:75233261-75233283 AAGCTGCTAGCCCCTGACGCAGG No data
1129393691_1129393701 4 Left 1129393691 15:75233208-75233230 CCTTCCCCGTGGTCCCTGGAGCC No data
Right 1129393701 15:75233235-75233257 TCAGCGATGAGGAGGCTTCTGGG No data
1129393691_1129393697 -7 Left 1129393691 15:75233208-75233230 CCTTCCCCGTGGTCCCTGGAGCC No data
Right 1129393697 15:75233224-75233246 TGGAGCCAATGTCAGCGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129393691 Original CRISPR GGCTCCAGGGACCACGGGGA AGG (reversed) Intergenic
No off target data available for this crispr