ID: 1129393805

View in Genome Browser
Species Human (GRCh38)
Location 15:75233681-75233703
Sequence GGTCCAGGTGGGGCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129393800_1129393805 -6 Left 1129393800 15:75233664-75233686 CCAGTGCTGATGGGGCTGGTCCA 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG 0: 1
1: 0
2: 4
3: 54
4: 399
1129393798_1129393805 -1 Left 1129393798 15:75233659-75233681 CCAGGCCAGTGCTGATGGGGCTG 0: 1
1: 0
2: 4
3: 40
4: 338
Right 1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG 0: 1
1: 0
2: 4
3: 54
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129393805 Original CRISPR GGTCCAGGTGGGGCCCTGCC TGG Intergenic
900147310 1:1163877-1163899 GGTACAGGTGGGGCTCAGCCCGG + Intergenic
900147510 1:1164880-1164902 TGTGCAGGTGGGACCCGGCCAGG + Intergenic
900190922 1:1351888-1351910 GGTCCAGCTGGGGCCCTGACAGG + Intergenic
900319547 1:2075779-2075801 GGGTCTGGTGGGGACCTGCCAGG + Intronic
900322654 1:2092812-2092834 GGGCCAGGTGGACCCCTGCAGGG + Intronic
900350060 1:2230093-2230115 GGTCCAGCTGGGCCACGGCCCGG + Intronic
900465873 1:2825204-2825226 GGGCCAGGTGAGGGCATGCCTGG + Intergenic
900550541 1:3252343-3252365 GGCCCACCTGGGGCCCGGCCTGG - Intronic
901425884 1:9182310-9182332 GGACCAGGTGGGGGCCAGGCAGG + Intergenic
901529187 1:9842972-9842994 GTGCCAGCTGGGCCCCTGCCGGG - Intergenic
901704056 1:11060208-11060230 GGGCCACGTGGGGCCCGGCCGGG + Intergenic
901769376 1:11522686-11522708 GGTCCTGGCTGGGCCCTGGCTGG - Intronic
901769395 1:11522730-11522752 GGTCCTGGCTGGGCCCTGGCTGG - Intronic
901769464 1:11522939-11522961 GGTCCTGGTTGGGCTCTGGCTGG - Intronic
901875219 1:12163640-12163662 GTTCGTGGTGGGGCTCTGCCTGG + Intergenic
902250696 1:15153018-15153040 GGCCCAGGTGGGGCCCATTCCGG - Intronic
902624433 1:17668378-17668400 GGCCCGGGTCAGGCCCTGCCTGG + Intronic
903652886 1:24932020-24932042 TGGCCAGGTAGGGCCCTGGCCGG + Intronic
904879508 1:33684711-33684733 GGTGGAGGTGAGGCCCTCCCAGG - Intronic
905199540 1:36306749-36306771 GGTGCAGGTGAGGCCGAGCCAGG + Exonic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
906526745 1:46497990-46498012 GCCCCAGGCCGGGCCCTGCCTGG - Intergenic
906688686 1:47778706-47778728 GGTCCTGGTGCCACCCTGCCTGG + Intronic
906725879 1:48043928-48043950 GGCCCAGCTGGGGCTCTGCCTGG + Intergenic
906806837 1:48787321-48787343 GGTCCAGGTGAGATCCTGACAGG + Intronic
907396889 1:54197205-54197227 GGTGCAGGTGAAGGCCTGCCTGG + Intronic
907586427 1:55621799-55621821 TGTCCAAGTGGGGACCTGCCAGG - Intergenic
907909510 1:58814390-58814412 GGCGTGGGTGGGGCCCTGCCGGG + Intergenic
912454436 1:109788309-109788331 CGCCCTGGTGGGGCCCAGCCCGG + Intergenic
914195643 1:145446737-145446759 GGACCAGGTGGGGCGGTGGCGGG - Intergenic
914428432 1:147599694-147599716 GGTCCGGGGCGGGCCCTGGCGGG + Intronic
914667544 1:149843408-149843430 GCTCCAAGTGAGTCCCTGCCGGG + Intronic
914668223 1:149850382-149850404 GCTCCAAGTGAGTCCCTGCCGGG - Intronic
914672990 1:149886248-149886270 GCTCCAAGTGAGTCCCTGCCGGG - Exonic
915901334 1:159848577-159848599 GGTTTAGGTTGGGGCCTGCCTGG - Intronic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
916803112 1:168232754-168232776 AGTCCAGTTTGGTCCCTGCCAGG + Intronic
918809246 1:189094234-189094256 GGCCCAGATGGGGCCCTGGCAGG - Intergenic
919353912 1:196496734-196496756 CGTCCAGGTGGGATCCTGCCTGG - Intronic
920089122 1:203439996-203440018 GGTACAGGTGGAGGCCTTCCTGG + Intergenic
922909671 1:229205023-229205045 GGTGGAGGGGGGGCACTGCCTGG + Intergenic
923885638 1:238152192-238152214 GGTCCAGTTTTGGTCCTGCCGGG + Intergenic
924384831 1:243490875-243490897 GGTGCTGCTGGGGCCCTCCCTGG - Intronic
1062982641 10:1737758-1737780 CCTCCAGGAGGGACCCTGCCCGG + Intergenic
1063154502 10:3366313-3366335 GGTCCAGGTAGGGCAATGACTGG + Intergenic
1066984678 10:42454520-42454542 GCCCCAGCTGGGGCCATGCCTGG - Intergenic
1067066491 10:43106805-43106827 GGGTGTGGTGGGGCCCTGCCAGG - Intronic
1067296941 10:44980029-44980051 GTTCCAGGTGGGGCTGTGGCTGG - Intronic
1067808792 10:49411035-49411057 GGTCCTGGTGGGCTCCTGCCTGG - Intergenic
1069988324 10:72298845-72298867 GGCCCAAGCGGGGCCCTTCCAGG + Intergenic
1073249188 10:102111379-102111401 TCTCCAGGTGGGATCCTGCCTGG - Intronic
1074329354 10:112489113-112489135 GGCCCAGGTGGGGCCGAGACAGG + Intronic
1074769892 10:116726456-116726478 GGAGCTGGTGGGGTCCTGCCAGG - Intronic
1075690051 10:124388613-124388635 GATCAAGGTGGGCCCCAGCCAGG + Intergenic
1075797206 10:125129246-125129268 AGTCCCCTTGGGGCCCTGCCAGG - Intronic
1076321916 10:129589357-129589379 GGCCCAAGTGAGGCCCTGGCAGG - Intronic
1076531382 10:131147572-131147594 GTTCCAGGTGTGGACCTCCCAGG + Intronic
1076598680 10:131643003-131643025 GACCCAGGTTGGGCCCTGCTGGG + Intergenic
1076634460 10:131873312-131873334 GGTGCAGGTGCGGACATGCCAGG - Intergenic
1076635545 10:131880063-131880085 GGTGTGGGTGGGGCCCAGCCAGG + Intergenic
1076671360 10:132122523-132122545 AGAGCAGGTGTGGCCCTGCCCGG - Intronic
1076874986 10:133211424-133211446 GGTCGAGGTGGGGTCCTGGTGGG - Exonic
1077012240 11:384526-384548 GGGCCGGGTGGGGGCCTTCCTGG - Intergenic
1077014091 11:392384-392406 GGCCCACCTGGGGCCCTGCAGGG - Intergenic
1077014796 11:394738-394760 GGCACAGGTGGGGCCTGGCCAGG - Intronic
1077024719 11:433985-434007 GGGCCAGGTGGGGCCCGGGAGGG + Intronic
1077187692 11:1242837-1242859 GGTCCAGGTGGTGCCCAGGGAGG - Exonic
1077188115 11:1244508-1244530 GGTCCAGGTGGTGCCCAGGGAGG - Exonic
1077189070 11:1248279-1248301 GGTCCAGGTGGTGCCCAGGGAGG - Exonic
1077189633 11:1250463-1250485 GGTCCAGGTGGTGCCCAGGGAGG - Exonic
1077230489 11:1456293-1456315 GGGCCAGGGTGGGACCTGCCAGG + Intronic
1077290038 11:1784845-1784867 GGCCCAGGTGGGCACCTGCCAGG - Intergenic
1077337641 11:2012556-2012578 AGGCCAGGTGGGGACCCGCCCGG - Intergenic
1077350446 11:2090793-2090815 GGTCTTGGTGGGACCCTGCAAGG - Intergenic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1077500895 11:2909376-2909398 AGTCCAGGTGGGGCCGGGTCGGG + Intronic
1077635817 11:3840878-3840900 GCACCAGGTGAGGCCCGGCCGGG - Exonic
1080642757 11:34167243-34167265 GGTCCAGGTGAGCTCCTGCCAGG - Exonic
1081669070 11:44933310-44933332 CTGCCAGGTGGGCCCCTGCCAGG - Exonic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1083859439 11:65412015-65412037 ACCCCAGGTAGGGCCCTGCCTGG - Exonic
1083861695 11:65423413-65423435 GGCCCAGGCCGGGCCCAGCCTGG + Intergenic
1084196005 11:67523878-67523900 GGCCCAGCTGGGGTCCTGGCAGG - Intergenic
1084953260 11:72678247-72678269 GCTCCAGGTGGGGCCAGGTCTGG + Intergenic
1084961353 11:72718370-72718392 GGTCCAGCTGAGGCCCGGCTTGG + Intronic
1086318346 11:85616997-85617019 GGTTAAGGTGGGGTTCTGCCTGG - Intronic
1089581111 11:119482550-119482572 GGTCCAGGGAGGTCACTGCCAGG + Intergenic
1089678599 11:120107051-120107073 GGTTCAGGTGTGGACCTGCCTGG - Intergenic
1089687827 11:120168384-120168406 CGTCCAGTTGGGTGCCTGCCTGG - Intronic
1091221421 11:133931852-133931874 GGCCCAGCTGGGACCCAGCCTGG - Intronic
1202820625 11_KI270721v1_random:67738-67760 AGGCCAGGTGGGGACCCGCCCGG - Intergenic
1091822529 12:3487038-3487060 GGCCCAGGTGTGGGGCTGCCTGG + Intronic
1093801234 12:23375688-23375710 GGGACTGGTAGGGCCCTGCCAGG + Intergenic
1093972045 12:25384566-25384588 GGTCTGGGTGGGGACCTTCCAGG - Intergenic
1095825998 12:46531059-46531081 GGGCAAGGTGGGGGCCTTCCTGG - Intergenic
1096495554 12:52037437-52037459 GGGCCAGGTGAGGGGCTGCCGGG + Intronic
1097037033 12:56130796-56130818 GGCCCAGGTCTGGCCCTTCCTGG + Exonic
1097114438 12:56687513-56687535 GGTCCGCGTGGGGCTCTCCCAGG + Intronic
1098570275 12:71980472-71980494 AGTCCAGGTAGGTCCCTGTCAGG + Intronic
1101135440 12:101739091-101739113 GAGCGAGGTAGGGCCCTGCCCGG + Intronic
1102163123 12:110785479-110785501 GGACCAGATGGGCCCCTGACTGG - Intergenic
1102164795 12:110797597-110797619 GGGCCTGGAGGGGCCCTGACTGG + Intergenic
1103450918 12:121028314-121028336 GCTCCAGGATGGGCCCTGACTGG + Intronic
1103700740 12:122847618-122847640 AGGCCAGGTGGGCCCCAGCCGGG + Intronic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1105426978 13:20302354-20302376 GGCCCAGGAGGAGCCCTCCCGGG - Intergenic
1106328617 13:28718525-28718547 GGTACAGGTCGGGCCGTGCCAGG + Exonic
1108848221 13:54700103-54700125 GGTCCAGCTGTGGCCATGCATGG - Intergenic
1112586296 13:100721662-100721684 GGCCCAGCTGGGGCCATGCAGGG + Intergenic
1113614101 13:111669027-111669049 GGTCTGCGTGTGGCCCTGCCTGG + Intronic
1113619568 13:111753941-111753963 GGTCTGCGTGTGGCCCTGCCTGG + Intergenic
1113669975 13:112170091-112170113 GGTGCAGGTGGGGTGCTGCCTGG - Intergenic
1113720700 13:112553707-112553729 GGTTGAGGAGGGGCCCTGCTGGG - Intronic
1113947104 13:114050563-114050585 ATGCCAGGTGAGGCCCTGCCCGG + Intronic
1114253684 14:20983469-20983491 TGTCCAGGTGCTGCTCTGCCTGG + Intergenic
1114557391 14:23569880-23569902 AGGAAAGGTGGGGCCCTGCCTGG - Intronic
1120830847 14:88996171-88996193 CCTCCAGGTGGGGGCCTGCCTGG + Intergenic
1120853948 14:89196691-89196713 TGTCCTGATGGGTCCCTGCCAGG + Intronic
1120951478 14:90045915-90045937 TTTCCAGGTGGGGCCCCCCCAGG - Intergenic
1122032078 14:98919590-98919612 GGCCAAGGTGGGGACCTGCTGGG - Intergenic
1122063728 14:99157496-99157518 GGCATAGGTGGGGCACTGCCGGG + Intergenic
1122298594 14:100719234-100719256 GGTCCAGTTGGAGCCCAGCAGGG - Intergenic
1123029771 14:105446200-105446222 GGTGCAGGTGGGGCCCAGCTCGG - Intronic
1123035436 14:105469986-105470008 AGACCAGGTGGGGCCTTCCCAGG + Exonic
1123110403 14:105864470-105864492 GGGCCATGTGGGGCCCTCCGGGG - Intergenic
1123945512 15:25236969-25236991 GGTCTAGGTGGAGCTCTGGCTGG + Intergenic
1124376659 15:29133034-29133056 GGTCCATCTGCCGCCCTGCCCGG + Intronic
1124392790 15:29274718-29274740 GGTCCAGCTGGGGCCCTTCGAGG - Intronic
1124416461 15:29476558-29476580 TGTCCAGGTCTGGCCCTGCCTGG - Intronic
1128067993 15:64775991-64776013 GGTCCCTGGGCGGCCCTGCCCGG + Intergenic
1129198600 15:73985399-73985421 TGTCCAGGTTGGGCCCAGCTGGG + Exonic
1129255754 15:74333119-74333141 GGTCCAGGTGGAGGCCAGCCAGG - Intronic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129460293 15:75697061-75697083 GGGGAAGGTGGGGCCCTGGCCGG - Intronic
1129665905 15:77579230-77579252 GGTCCAGCTGGCGCTCTGTCTGG + Intergenic
1129692632 15:77722390-77722412 AGGCAAGCTGGGGCCCTGCCTGG + Intronic
1129834105 15:78691264-78691286 GGTCCTGTGGGGGCCCTTCCTGG - Intronic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1130520364 15:84657122-84657144 GGCCCAGCTGGGGCCATCCCCGG - Intronic
1131092426 15:89632804-89632826 CAGCCAGGTGAGGCCCTGCCAGG - Exonic
1131468189 15:92672606-92672628 GTCCCAGGTGGGGCAGTGCCTGG - Intronic
1132232289 15:100193126-100193148 GGGACAGGTGGAGCCCTGCAAGG - Intronic
1132393241 15:101454015-101454037 AGTCCAGGAGGGGGCCTGGCAGG - Intronic
1132843589 16:1990129-1990151 GGTCCAGGGCGGCCCCTGCGCGG - Exonic
1132869323 16:2108725-2108747 CGTCCAGGTGCTGGCCTGCCGGG - Exonic
1132891798 16:2208353-2208375 GGCCCGGGAGGGGACCTGCCTGG + Intronic
1133774116 16:8884517-8884539 GGTCCGGGTGGGTCCCTGCAGGG + Intergenic
1134718091 16:16366873-16366895 CGTCCAGGTGCTGGCCTGCCGGG + Intergenic
1134956661 16:18385286-18385308 CGTCCAGGTGCTGGCCTGCCGGG - Intergenic
1136040055 16:27571640-27571662 GGGCCCTGTGGGGCCCTGCAGGG + Intronic
1136390826 16:29963155-29963177 GGTGCAGGTTGTGCCCTGCCTGG - Exonic
1137293150 16:47065911-47065933 GGTCTGGGAGGGGCTCTGCCAGG + Intergenic
1137673759 16:50293641-50293663 GGTCAATCTGGGGCCCTCCCTGG + Intronic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138496583 16:57412697-57412719 AGTCCAGGTGCTGCCCTGCCTGG + Intronic
1138512222 16:57515325-57515347 AGTCCAGGTGGGCCCCGGGCAGG - Exonic
1139484540 16:67248464-67248486 GGTCCGGGTGGGGGCCGGCAGGG + Intronic
1139561226 16:67743670-67743692 GGCCCAGATGTGGCCCTGCAGGG - Intronic
1139956564 16:70696061-70696083 GGGCTAGGTGTGGCCCTGCCTGG - Intronic
1141741865 16:85898917-85898939 GGTCCAGGGGCGGCGCTGCAGGG - Exonic
1142177341 16:88651200-88651222 GGCATAGGAGGGGCCCTGCCCGG + Intergenic
1142184347 16:88687328-88687350 GGGCCAGGTGGGGCCGTCTCTGG + Intergenic
1142224970 16:88872790-88872812 GGTCCTGGGGCGGCCCTGGCAGG + Intergenic
1142379140 16:89721793-89721815 GGGCCCGGTGGGGTCCTGCGGGG + Exonic
1143026056 17:3942590-3942612 TGTGAAGGTGGGGGCCTGCCTGG - Exonic
1143117547 17:4589298-4589320 GGTCCAGGCGGGGCTCTGGGGGG - Intronic
1143376627 17:6471130-6471152 GGTCCTTTTGGGGCCCTGCCTGG - Intronic
1143526971 17:7478824-7478846 GGTCTGGGTAGGGCCCTCCCTGG - Intronic
1143543454 17:7582875-7582897 GGGGCTGCTGGGGCCCTGCCAGG - Intergenic
1143734448 17:8900674-8900696 GCTCCAGCTGCTGCCCTGCCTGG + Intronic
1144948758 17:18982955-18982977 AGTACAGGTGGGGCCCTCCCAGG + Intronic
1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG + Exonic
1145906983 17:28521672-28521694 GGTCTAGGTGGGGGCCTGGTGGG - Intronic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1146656081 17:34636090-34636112 GGCCCAGGTGGTGGCCAGCCTGG + Exonic
1147095366 17:38135572-38135594 GTCCCAGGTCGGGCCCTGGCTGG - Intergenic
1147456861 17:40543242-40543264 GGGCAAAGTGGGGACCTGCCAGG + Intergenic
1147769330 17:42856789-42856811 GCTCCAGGCTGGGCCATGCCTGG - Exonic
1148474322 17:47916971-47916993 GGTCCAGGTGGTGCCCCCCAAGG + Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148793345 17:50185738-50185760 CGGAGAGGTGGGGCCCTGCCTGG + Intronic
1151540629 17:74763058-74763080 GGCCGGGGTGGGGCCCAGCCTGG - Intronic
1152445018 17:80337424-80337446 GGTCCAGCTGGGGCGCTGGGTGG + Intronic
1152544239 17:80992573-80992595 GGTCCTGCCGGGGTCCTGCCGGG + Intronic
1152553684 17:81042541-81042563 TGTCCAGGCGTGCCCCTGCCTGG + Intronic
1152570369 17:81118983-81119005 TGCCCAGGTGGAGCCCTGCTGGG - Intronic
1152640912 17:81448854-81448876 GGTCCAGGTGGAGCCCACCCTGG - Intronic
1152739907 17:82014312-82014334 GGTCCAGGTGGGGTAGGGCCTGG - Intronic
1152749561 17:82056412-82056434 GGGTGAGGTGGGGCCCTGCCTGG + Intronic
1154388035 18:13913221-13913243 GGTCCAGGTGAGGCTGTGCAGGG - Intronic
1154405883 18:14090657-14090679 GGTCCAGGGGAGCCCCTTCCTGG + Intronic
1154474919 18:14747001-14747023 GATCGAGGTGGAGACCTGCCTGG - Intronic
1155182053 18:23356390-23356412 GGGCCAGCTTGGGCCCTGCCAGG - Intronic
1156464745 18:37341683-37341705 GCTCCAGAGGGGACCCTGCCTGG + Intronic
1158401354 18:57124064-57124086 TGTCCAGGTGTGGCCCTGGAAGG + Intergenic
1160369746 18:78362312-78362334 GGTCCAGGTGGAGCGATTCCAGG - Intergenic
1160776948 19:860942-860964 TGTCCGGGTGGGGCACTGCGCGG - Exonic
1160790374 19:920209-920231 GGTCCAGGAGGGGCGGTGCGAGG + Intronic
1160955218 19:1688187-1688209 GGCCAAGGTGGGGCCCAGGCAGG + Intergenic
1161072912 19:2271245-2271267 GGACCGGGTGGGCCCCTGCCTGG + Intronic
1161544623 19:4872797-4872819 GTCCCAGATGGGTCCCTGCCTGG + Intergenic
1161579903 19:5075098-5075120 GGACCAGGAGGGGCACTCCCGGG - Intronic
1161590803 19:5128347-5128369 GCCCCAGGTGGGGCCCTCCTGGG + Intronic
1161672590 19:5622470-5622492 GGTGCAGGCGGGGGCGTGCCCGG + Intronic
1161951764 19:7471523-7471545 GGTACATGTGAGCCCCTGCCAGG + Exonic
1162440303 19:10688353-10688375 GGGCCAGCTGGAGCCCTGCAGGG - Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163426426 19:17243349-17243371 GGTCTCGCTGGGGCCCAGCCTGG - Intronic
1163472301 19:17504725-17504747 AGTCCAGGATGGGCCGTGCCAGG - Exonic
1163511763 19:17739645-17739667 GGGCGTGGTGGAGCCCTGCCTGG + Intergenic
1163530004 19:17843364-17843386 TGCCCAGGTGGGGTTCTGCCTGG - Exonic
1163604123 19:18264932-18264954 CGGCCAGGCGGTGCCCTGCCAGG - Exonic
1163635895 19:18437162-18437184 AGTCTAGGTGGGGCCCAGGCCGG - Intronic
1163786165 19:19275939-19275961 AGGGAAGGTGGGGCCCTGCCTGG + Intergenic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1165609192 19:37135457-37135479 GGGCGAGGTGGGGGCCTGCTTGG - Intronic
1166283645 19:41810642-41810664 GGTGCAGGGTGGGCCCAGCCAGG + Intronic
1166354120 19:42217136-42217158 GGTGCGGGAGCGGCCCTGCCCGG - Intronic
1166410691 19:42554054-42554076 GGTGCAGGGTGGGCCCAGCCAGG - Intronic
1166784126 19:45357614-45357636 ACTTCAGGTGGGACCCTGCCCGG - Exonic
1166807617 19:45496730-45496752 GGTTCAGGTGGGGTACTCCCCGG - Intronic
1167498977 19:49835218-49835240 GGGCCATGTGGGGCCCGGGCAGG - Intronic
925132140 2:1501731-1501753 GGTCCTGGGGGGCCCATGCCTGG - Intronic
927893302 2:26765689-26765711 GGAACAGGTGGGGCCCACCCAGG - Intronic
927904972 2:26849181-26849203 GGTGCAGGTGGCGCCCGGCGAGG + Intronic
929457543 2:42076587-42076609 TGTCCATGTGGGGCTCAGCCGGG - Intergenic
929511641 2:42569221-42569243 CGTCCAGCTGGGCCCCTGGCTGG - Intronic
931516447 2:63053038-63053060 GGTCCATGGCGGGCCCGGCCAGG - Exonic
931996729 2:67845887-67845909 GGTCCAGGGGAAGCCCTGCCAGG + Intergenic
932093221 2:68825035-68825057 GTGCCAGGTGGCCCCCTGCCAGG - Intronic
932497261 2:72152205-72152227 GGTTCAAGTGGAGCTCTGCCTGG + Intergenic
932567025 2:72916926-72916948 GGGCCAGGCGGGGCACTGCGCGG - Intronic
937317437 2:120940884-120940906 GGTGCATGCGGGGCCCTGGCCGG + Intronic
937588404 2:123584672-123584694 GGTCCAGGTCAGGCCCACCCAGG - Intergenic
937869828 2:126778870-126778892 GTCCCAGGTGAGGCCCAGCCTGG - Intergenic
938252668 2:129827705-129827727 GGTGCAGGCAGGGCCCTGCTGGG + Intergenic
938338353 2:130518724-130518746 GGAGGAGGTGGGTCCCTGCCAGG - Intergenic
938351486 2:130602026-130602048 GGAGGAGGTGGGTCCCTGCCAGG + Intergenic
942901505 2:181125492-181125514 GGTCCAGGTGATGCAGTGCCTGG - Intergenic
943669682 2:190648434-190648456 GGTCCAGGTGCGCCCCTGCCCGG - Intronic
946190686 2:218006277-218006299 GGCCCAGGGAGGGGCCTGCCAGG - Intergenic
946252806 2:218423847-218423869 GATCGAGGTGAGGCCCTGTCTGG + Exonic
946351784 2:219160275-219160297 GGACCGGGCGGGGCCCAGCCGGG - Intronic
946360894 2:219218805-219218827 GGTCCACGTGCGTCCCTTCCCGG - Exonic
947335628 2:229079957-229079979 GGTCCAGGAGGGAGCTTGCCTGG + Intronic
947441600 2:230126742-230126764 GGTCCAGGTGGGGATTTGCATGG + Intergenic
948139457 2:235661794-235661816 GGGACAGGTGGGGCCATGTCTGG + Intronic
948207072 2:236168067-236168089 GGTCCCGCTCGGCCCCTGCCCGG - Exonic
948465543 2:238150088-238150110 GGTGCAGGGTGGGCCCTGCCAGG + Intronic
948600323 2:239104187-239104209 GGTGCAGTTGGGGCCCTGGGCGG + Intronic
948739406 2:240033153-240033175 GGGCCAGGCTGGCCCCTGCCTGG + Intergenic
948854829 2:240725197-240725219 GGGCCAGGCAGGGCTCTGCCTGG - Intronic
948867365 2:240782752-240782774 GGCCCTGGAGGGACCCTGCCTGG - Intronic
1168997446 20:2143838-2143860 GGTACAGGTGGTGGCCTGGCCGG + Exonic
1169120541 20:3093145-3093167 GGCTCAGACGGGGCCCTGCCGGG - Intergenic
1169422774 20:5473222-5473244 GGTCCTGGTGGAGCTCTTCCAGG + Intergenic
1169426650 20:5502253-5502275 GGTCCTGGTGGAGCACTTCCAGG - Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171206099 20:23282709-23282731 AGTCCTGGTGGGACCCAGCCCGG - Intergenic
1171405671 20:24910852-24910874 TCTCCAGGTGGGGCCCTGGGTGG + Intergenic
1172107619 20:32526240-32526262 GGCCCATGTGGGCCCCAGCCTGG + Intronic
1172791312 20:37507347-37507369 GGTCCAGGTGGGGTCCAGGAGGG - Intronic
1172930947 20:38586155-38586177 GTGCCAGGTGAGGCCCTTCCAGG + Exonic
1173206997 20:41002996-41003018 GGTCAAGCTGGGGCTCTGCAGGG + Intergenic
1173225030 20:41157559-41157581 AGCCCTGGAGGGGCCCTGCCTGG + Intronic
1173501728 20:43558864-43558886 GCTCCTGGATGGGCCCTGCCTGG - Intronic
1174246822 20:49188072-49188094 GGGCCTGGTGGGGCCCTCGCGGG - Intronic
1174404828 20:50296326-50296348 GGTCCAGGCTGGACCCAGCCTGG - Intergenic
1174449052 20:50608813-50608835 GTTGCAGCTGGGGCTCTGCCTGG - Intronic
1174484935 20:50855160-50855182 GGTGAGGGTGGGGCCTTGCCTGG - Intronic
1174929065 20:54793788-54793810 GGGCCCAGGGGGGCCCTGCCGGG + Intergenic
1175161525 20:57011558-57011580 GGACCAGGTGGGTTCCTGCCAGG + Intergenic
1175186671 20:57183659-57183681 GGTCCCGCCGGGGCCCTGCTGGG + Intronic
1175237458 20:57524843-57524865 GGTAAAGCAGGGGCCCTGCCAGG - Intronic
1175511069 20:59526443-59526465 CATCCAGGTGGGGTCCAGCCTGG + Intergenic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175879198 20:62246994-62247016 TGGCCAGGTTAGGCCCTGCCAGG + Intronic
1175894674 20:62330807-62330829 GGTCCAGCTGGGGACATGGCTGG + Exonic
1175915865 20:62425496-62425518 GGCCCAGCTGTGGCCCTGGCAGG + Intronic
1175938809 20:62527883-62527905 TGTCCAGGTGGGTTCCCGCCTGG - Intergenic
1176063483 20:63182416-63182438 GGCCAGGGTGGGGCCCAGCCCGG + Intergenic
1176170685 20:63695143-63695165 GGTCCCGGTGGCTCCATGCCCGG - Exonic
1176411333 21:6451007-6451029 GGGCCCGGTGGGGCCCTGCGGGG - Intergenic
1178551505 21:33543273-33543295 GGCCCAGGCGGGGCCCTAGCGGG - Intronic
1178910529 21:36669739-36669761 GTGCCATGTGGGGCCCAGCCAGG + Intergenic
1179423379 21:41253646-41253668 AGTCCAGGTGGGTCACAGCCGGG + Intronic
1179686826 21:43059329-43059351 GGGCCCGGTGGGGCCCTGCGGGG - Intronic
1179942878 21:44650982-44651004 GGTCCAGGTGGCGCCCCACCAGG + Intronic
1179985456 21:44918379-44918401 GTACCTGGTGGGGCCCGGCCTGG + Intronic
1180041776 21:45283838-45283860 GGTCCAGGCTGTTCCCTGCCAGG + Intronic
1180655660 22:17418802-17418824 CTTCCACGTGGGGCCCAGCCCGG + Intronic
1180841350 22:18960294-18960316 GGGCCAAGCGGGGCTCTGCCTGG - Intergenic
1180846278 22:18984192-18984214 GGTCCTGTGGGGGCCCTGCGTGG - Intergenic
1180879096 22:19191322-19191344 TGTCCAGGTGTGGTCCAGCCGGG + Exonic
1180943934 22:19679443-19679465 TGTCTAGCTGGGGCCCAGCCAGG - Intergenic
1180975151 22:19844097-19844119 GAGCCAGGTGGGGCCCAGCACGG + Intronic
1181044922 22:20209947-20209969 GCACCAGCTGAGGCCCTGCCAGG + Intergenic
1181050769 22:20237328-20237350 GGGGGAGGTGGGGCTCTGCCAGG - Intergenic
1181060148 22:20278500-20278522 GGGCCAAGCGGGGCTCTGCCTGG + Intronic
1181085974 22:20439489-20439511 CATCCAGGTGGTGCCCTCCCTGG - Intronic
1181820630 22:25472582-25472604 TATCCAGGTGGGGGCATGCCGGG + Intergenic
1183156449 22:36079251-36079273 GGTGCAGGAGGGGGCCTGGCAGG + Intergenic
1183232204 22:36590078-36590100 GATGCAGCTGGGGCCCTGCTGGG - Intronic
1183354198 22:37349653-37349675 GGTGCAGGTGGGGCCTTGCAGGG + Intergenic
1183356895 22:37364468-37364490 GGGCCAGCTGGGGCCCAGGCAGG + Intergenic
1183439191 22:37813603-37813625 GGCCCAGGTGGGGCGACGCCTGG + Exonic
1183675912 22:39298746-39298768 GGGCCAGGTGAGTCCCTGCCAGG + Intergenic
1184013516 22:41767704-41767726 GTACCATGTGGGGCCCTGTCAGG + Intronic
1184087193 22:42271971-42271993 GGACCACCTGGGGCTCTGCCTGG - Intronic
1184335165 22:43848608-43848630 GGGCCAGGTGGGGCCAAGGCAGG + Intronic
1184459394 22:44628489-44628511 ACTCCAGGTGAGGCCCTCCCAGG + Intergenic
1184479137 22:44736976-44736998 GGTCCCGGTGGGGCCCTGGCCGG - Exonic
1184599007 22:45531753-45531775 GGCCCTGGTGAGGCCCTGCTGGG + Intronic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
1184861594 22:47175971-47175993 GGTCCAGGCTGGCCCCTGTCAGG + Intergenic
1185298013 22:50063770-50063792 GGCCCATGGGGGGCCCAGCCAGG - Intronic
950144164 3:10635929-10635951 GGTCCAGGGGGCCCTCTGCCTGG - Intronic
950407332 3:12812982-12813004 GGTCCAGGTGAGCCCCTGCAGGG - Exonic
950425325 3:12922104-12922126 CGTTCAGGTGGGGCCCGGGCTGG - Exonic
950645117 3:14372509-14372531 GGTCCAGGGGCGGGGCTGCCTGG - Intergenic
952254441 3:31683401-31683423 GGTCCAGGTGGGCGGCTGTCAGG + Intronic
952399122 3:32947678-32947700 ACTCCTGGTGTGGCCCTGCCTGG + Intergenic
952897091 3:38085022-38085044 AGGTCAGGTGGGGCCATGCCTGG - Intronic
952961121 3:38589709-38589731 GGTCCAAGTGAGGCGCTACCCGG - Intronic
953133952 3:40166940-40166962 GGAGCAGGAGGGGCCCTACCAGG - Exonic
954008198 3:47610158-47610180 GCTCCAAGTGGGGCCAGGCCAGG + Exonic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
960947695 3:122978187-122978209 GGCCCAGGTGGGGCCAGGCCTGG - Intronic
961322158 3:126083823-126083845 GGGCGGGGTGGGGCCATGCCTGG - Intronic
961360584 3:126364815-126364837 GGCCCAGCAGGGGCCCTGGCTGG + Intergenic
961457825 3:127032992-127033014 GGGCCAGGAGGGAGCCTGCCAGG + Intronic
961458926 3:127038111-127038133 GGTCCAGGTTGGGGTCTGCCTGG - Intergenic
961754864 3:129121689-129121711 GGTCCGGGCGGGGCCGAGCCGGG - Exonic
962259731 3:133895130-133895152 GGTGCAGGTGCGGCGCTGCAGGG - Intronic
963250308 3:143096453-143096475 GGTCCAGCTGTAGCCCTGCAGGG + Intergenic
965803946 3:172523348-172523370 GGTCCAGGGGGGACCCAGCCTGG - Exonic
968614554 4:1571477-1571499 AGCCCAGGTGAGGCCCTGCCTGG - Intergenic
968652368 4:1765322-1765344 GGTGCAGGGAGGGGCCTGCCAGG + Intergenic
968816175 4:2823091-2823113 GGCCCAGCTGGGGCTCTGCTGGG - Intronic
968898174 4:3417243-3417265 GGTCATGGTGTGGCCCTGACAGG - Intronic
969618984 4:8269634-8269656 AGGCCAGGCGGGGCCCTGTCGGG + Intergenic
969620976 4:8278681-8278703 GGACCTGGTGGGGCCCTGCAGGG + Intronic
969652924 4:8478327-8478349 CTCCCAGGTGGGGTCCTGCCAGG + Intronic
970057273 4:11989040-11989062 GATCCAGAAGGGGCCCTGTCTGG + Intergenic
970696696 4:18686258-18686280 GGTCTGGTTGGGCCCCTGCCAGG - Intergenic
973162201 4:47032409-47032431 CGTCGACGGGGGGCCCTGCCGGG - Exonic
976557068 4:86461996-86462018 GGCCCAGGATGGGCCCTGCATGG - Intronic
979624159 4:122827152-122827174 GGTCCCTGCGGGGCCCGGCCGGG - Exonic
980871409 4:138615466-138615488 GGTTCAGGTGGGGCCTTTGCTGG - Intergenic
981713715 4:147732704-147732726 GGGCCAGGCGGGGCCCAGGCGGG - Intronic
982036076 4:151347222-151347244 GGTCCTGATGGGAGCCTGCCTGG - Intergenic
984834033 4:184002525-184002547 GAGCCAGGTGGGGCCCAGCAGGG + Intronic
985610227 5:883806-883828 GGTCAGCGTGGGGCCCTGACGGG - Intronic
985830772 5:2227717-2227739 CCTCCACATGGGGCCCTGCCTGG - Intergenic
985995119 5:3593463-3593485 TCTCCAGGTGGGGCCCAGCCAGG + Intergenic
992693219 5:79259814-79259836 GGGCAAGGTGGGGCCTTCCCAGG + Intronic
995061325 5:107814377-107814399 GGTCCAGGTCCAGCACTGCCAGG - Intergenic
997613637 5:135231872-135231894 GGTCAAGGTGGGTGACTGCCAGG + Intronic
998286183 5:140863055-140863077 GTTCCACGTGGGGCTCTGCACGG + Intronic
1002190016 5:177473240-177473262 GGGCCAGGCGGGGCACTGCCGGG - Intronic
1002580523 5:180207545-180207567 GGTAGAGGTGGGGCCCTGCCCGG - Intronic
1002639055 5:180622006-180622028 AGTCCAGCTGGGGCCCCTCCAGG - Intronic
1003077990 6:2999622-2999644 GGTCCATCTGGGGCCTCGCCCGG - Intronic
1003426340 6:6000432-6000454 GGGGCAGGTGGGGACCAGCCCGG - Intronic
1004252325 6:14032772-14032794 GGTGCAGGTGATGCCCTGCATGG + Intergenic
1004252350 6:14032887-14032909 GGTGCAGGTGATGCCCTGCATGG + Intergenic
1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG + Intronic
1006375904 6:33671469-33671491 GGACCAGAGGGGTCCCTGCCCGG + Intronic
1007417397 6:41699988-41700010 GGTCCCGGAGGGAACCTGCCAGG - Intronic
1007474049 6:42107340-42107362 GGTGGAGGTGGGGCCATGCTGGG + Exonic
1017125167 6:151058283-151058305 GGGCCAGCTGGGGCCGTGCCGGG + Intronic
1017769848 6:157636564-157636586 GGTCCTGCTGGGCTCCTGCCTGG + Intronic
1018583382 6:165328515-165328537 GGGCCAGGTGTGGCCCTGTGAGG - Intronic
1018847886 6:167567666-167567688 GGTCCAGCCGAGGTCCTGCCAGG + Intergenic
1018903882 6:168064189-168064211 GGTCAGGGTGGGGCCCAGCCAGG - Intronic
1019146565 6:169979035-169979057 GGGCCCGGTGCTGCCCTGCCAGG + Intergenic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1019527877 7:1488909-1488931 GGGCCAGGTGTGACCCTGCGTGG - Intronic
1019706160 7:2498190-2498212 CGTGCAGCTGGGGCCATGCCCGG + Intergenic
1019795357 7:3044197-3044219 AGTCCAGGTGGGGCCTTGGGAGG + Intergenic
1020098489 7:5381313-5381335 GGCCCAAGTGGGGACCTGGCCGG + Intronic
1020101652 7:5397350-5397372 GGCCCAGGCCGGCCCCTGCCCGG + Intronic
1021158354 7:17240113-17240135 GGCCCAGCTGGGACCCTGTCAGG - Intergenic
1021688402 7:23209953-23209975 GGTCCAGGGGGCTCCCTGCAAGG - Intergenic
1022210929 7:28208723-28208745 GATCAAGGTGGGGACCTTCCTGG + Intergenic
1022227045 7:28373958-28373980 GGTACTGGTGTGTCCCTGCCGGG - Intronic
1023984041 7:45085131-45085153 GACCCAGGTGGGGACCTGGCTGG - Exonic
1024644281 7:51358200-51358222 GGTCCACGTGGGTCCCTGTTAGG + Intergenic
1024956552 7:54926944-54926966 GATCCATGTGGGGTTCTGCCAGG - Intergenic
1026533977 7:71224776-71224798 GCCCCAGGTGGAGCCCAGCCTGG + Intronic
1028737989 7:94239793-94239815 GGCCGAGGTGGTGCTCTGCCAGG + Intergenic
1031986834 7:128168814-128168836 GGGCCAGGTGGGGAGCTGTCCGG - Intergenic
1032055303 7:128679835-128679857 GGAGCAGGTGTGACCCTGCCAGG + Intronic
1034196557 7:149252774-149252796 GGTCCTGGTGGTGCCCACCCAGG + Exonic
1035084010 7:156240707-156240729 GCCCCAGGTGGCTCCCTGCCAGG - Intergenic
1035099587 7:156385148-156385170 GGCCGACGTGGGGACCTGCCTGG + Intergenic
1035417973 7:158705229-158705251 GGTCGGGGTGGGGTCCTCCCGGG - Intergenic
1036557958 8:9876503-9876525 GGGCCAGGTGAGCCCCAGCCTGG - Intergenic
1036826048 8:11977076-11977098 GGTCCAGGTGGGCCAATCCCAGG + Intergenic
1037835752 8:22213901-22213923 GGTCCAGGGTAGGCCCAGCCAGG + Intergenic
1038176103 8:25183765-25183787 GCTCCAGGTGGCGCCCTCTCTGG - Intergenic
1038404540 8:27311500-27311522 GGTCCGGGCGGGTCCCTGGCCGG + Exonic
1039430453 8:37521442-37521464 TGTCCTGGGGGGGCCCTGCAGGG + Intergenic
1039592126 8:38757602-38757624 GGTCGCGGTGGGGTCCTGGCAGG - Intronic
1039800344 8:40949146-40949168 GGACCAGGTGGGACCCTGGCAGG + Intergenic
1039958043 8:42222114-42222136 GCTCCAGGTGGGTCTCAGCCAGG - Intergenic
1041641197 8:60204004-60204026 GGTTTAGGTGGGAACCTGCCTGG - Intronic
1041871039 8:62634642-62634664 GGCCCTGGTGGGGCTCTGCAGGG + Intronic
1042484637 8:69336786-69336808 TGTCCAGGTGGGACTGTGCCTGG + Intergenic
1045323710 8:101101341-101101363 AGGTCAGGTGGGGCCCTGTCAGG - Intergenic
1046674765 8:117095047-117095069 GGGGCAGGTGGGGCCTTCCCAGG + Intronic
1048293204 8:133195967-133195989 GGTCCAGGTGGGTTCCTGGGAGG + Intronic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1048331756 8:133475511-133475533 TGTACACCTGGGGCCCTGCCAGG - Intronic
1048432267 8:134381553-134381575 GGGCCAGGTGGGGCCATGCATGG + Intergenic
1049225594 8:141449109-141449131 GGGACAGGTGTGGCCATGCCAGG + Intergenic
1049306308 8:141906126-141906148 CTTCCTGGTGGGGCCCTGCTTGG + Intergenic
1049341985 8:142118113-142118135 GGTGCAGGGGGGACTCTGCCTGG - Intergenic
1049417003 8:142499858-142499880 GGTCCAGGTCTGGGCCTGTCTGG - Intronic
1049475136 8:142793821-142793843 GGCCCATGCTGGGCCCTGCCAGG + Intergenic
1049572881 8:143377868-143377890 GGCTCCCGTGGGGCCCTGCCAGG - Intronic
1049576381 8:143391787-143391809 GGGCCAGGTGGGGCACAGGCAGG - Intergenic
1049731662 8:144181328-144181350 GGGCCTGGTGGGGCCCGGGCAGG + Intronic
1049744347 8:144256892-144256914 GGTCCAGATGGGGCCTTGCAGGG + Intronic
1049799025 8:144509276-144509298 GTTCCAGGTGGGGTCCCGCAAGG - Exonic
1050182436 9:2935048-2935070 GGTCCAGCTGTGGCCTTGCAGGG + Intergenic
1052864659 9:33457660-33457682 GGCCAAGGTTGGGCCCTGTCTGG - Intergenic
1056538567 9:87552115-87552137 AGCCCAGGCAGGGCCCTGCCTGG + Intronic
1057793726 9:98141263-98141285 GCTCCAGGTACCGCCCTGCCAGG - Intronic
1057806357 9:98222572-98222594 AGTCCAGGCGTGGCCCTCCCTGG - Intronic
1060489220 9:124069840-124069862 GCTCCAGGTGGTGCCTTGCTGGG + Intergenic
1060687688 9:125626234-125626256 GGAACAGGTGAGGCCATGCCAGG - Intronic
1061193459 9:129095179-129095201 GCCCCAGGTCGGGCCCTGGCAGG + Exonic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1061823980 9:133246642-133246664 TGGCCAGGTAGGTCCCTGCCCGG + Intergenic
1061874815 9:133538418-133538440 AGTGCAGGTGAGGCCCGGCCCGG + Exonic
1061938941 9:133873858-133873880 GTTCTAGGCTGGGCCCTGCCTGG - Intronic
1061940239 9:133880097-133880119 GGTCCAGGTGGGTCCTTCCTTGG - Intronic
1062146582 9:134992719-134992741 GGTCCTTGTGGGGGCCTGTCAGG + Intergenic
1062288893 9:135785861-135785883 GGTCCAGATGGGTCCCAGGCCGG + Intronic
1062341177 9:136094656-136094678 GGTCCAGGTGGGCCCGTTCGTGG - Intronic
1062449263 9:136608684-136608706 GCGCCGGGTGGGGCCCAGCCTGG + Intergenic
1062499785 9:136847440-136847462 AGTCGGGGTGGGGCCCTGGCGGG - Exonic
1062566028 9:137164355-137164377 GGGCCAGGTCCGGTCCTGCCTGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1062628367 9:137453040-137453062 GGTCATGGTGAGGCCCAGCCCGG - Exonic
1062686836 9:137818024-137818046 GGTGCAGGTGAGGCCCTGGAAGG - Intronic
1062699023 9:137889613-137889635 GGACCAGGTGGGGCGGTGGCGGG + Intronic
1188841542 X:35023854-35023876 TGTCCAGGAGAGGCACTGCCAGG - Intergenic
1191846254 X:65550214-65550236 ACCCCAGGTAGGGCCCTGCCTGG + Intergenic
1192502422 X:71662784-71662806 GGTGCTGTGGGGGCCCTGCCCGG - Intergenic
1192528767 X:71869307-71869329 GGTGCTGTGGGGGCCCTGCCTGG - Intergenic
1193620689 X:83749960-83749982 GGTGCAGGTGGGGGCCCCCCAGG - Intergenic
1200046722 X:153407106-153407128 CATCCAGGTGGGGACATGCCAGG + Intergenic
1200074722 X:153545234-153545256 GGGCCACTTGGGGCCCAGCCTGG + Intronic
1200116213 X:153770805-153770827 GCACCAGGTGGGGACCTGCCAGG - Exonic
1200157550 X:153985349-153985371 GTTCCAGGCCGGGGCCTGCCTGG - Intergenic
1200166061 X:154036189-154036211 GGTCCAGGTGTGGCCCAGGGTGG + Intronic