ID: 1129393872

View in Genome Browser
Species Human (GRCh38)
Location 15:75234021-75234043
Sequence GCCTGTTCTGCCTGCCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129393870_1129393872 0 Left 1129393870 15:75233998-75234020 CCAGAGAGCTGCAAACAGGAGAT No data
Right 1129393872 15:75234021-75234043 GCCTGTTCTGCCTGCCACCCGGG No data
1129393868_1129393872 4 Left 1129393868 15:75233994-75234016 CCATCCAGAGAGCTGCAAACAGG No data
Right 1129393872 15:75234021-75234043 GCCTGTTCTGCCTGCCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129393872 Original CRISPR GCCTGTTCTGCCTGCCACCC GGG Intergenic
No off target data available for this crispr