ID: 1129399102

View in Genome Browser
Species Human (GRCh38)
Location 15:75269468-75269490
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 4, 1: 1, 2: 1, 3: 6, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129399090_1129399102 24 Left 1129399090 15:75269421-75269443 CCCGAGGTGTGACCCCATTATTT 0: 2
1: 4
2: 8
3: 6
4: 74
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184
1129399095_1129399102 10 Left 1129399095 15:75269435-75269457 CCATTATTTTGGCTCCAGAGCAG 0: 5
1: 9
2: 9
3: 20
4: 164
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184
1129399094_1129399102 11 Left 1129399094 15:75269434-75269456 CCCATTATTTTGGCTCCAGAGCA 0: 5
1: 12
2: 10
3: 14
4: 172
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184
1129399093_1129399102 12 Left 1129399093 15:75269433-75269455 CCCCATTATTTTGGCTCCAGAGC 0: 14
1: 10
2: 6
3: 23
4: 190
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184
1129399091_1129399102 23 Left 1129399091 15:75269422-75269444 CCGAGGTGTGACCCCATTATTTT 0: 2
1: 8
2: 2
3: 14
4: 147
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184
1129399097_1129399102 -4 Left 1129399097 15:75269449-75269471 CCAGAGCAGCTTTATGGACCTCC 0: 4
1: 13
2: 10
3: 12
4: 107
Right 1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG 0: 4
1: 1
2: 1
3: 6
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900033120 1:385549-385571 TTCCCGAAGGAGAAAGCTGCAGG - Intergenic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900590545 1:3457563-3457585 CTCCGGAAGGATAAGGGGGCAGG + Intronic
900654140 1:3746883-3746905 GTCCCACAGGAGAAGGGGGAGGG + Intergenic
902129756 1:14249578-14249600 CTCCCCAAGGGGAAGCCAGATGG + Intergenic
902394414 1:16124874-16124896 CTCATGTGGGAGAAGGCGGAGGG + Exonic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903751365 1:25623186-25623208 CTACGGAAGGAGGAGGCGTATGG - Intronic
911591260 1:99750756-99750778 TTCCAGAAGGAGAAGAGGGAAGG + Intronic
913684020 1:121214683-121214705 CTCCAGAAGGATATGGCTGAAGG - Intronic
914035859 1:144002298-144002320 CTCCAGAAGGATATGGCTGAAGG - Intergenic
914153597 1:145065647-145065669 CTCCAGAAGGATATGGCTGAAGG + Intronic
915835268 1:159171431-159171453 CTCCCGGGGGAGAGGGTGGAAGG + Intergenic
916627069 1:166569944-166569966 CTCTTGTAGGAGAAGGCTGAAGG + Intergenic
920471325 1:206233175-206233197 CTCCAGAAGGATATGGCTGAAGG - Intronic
920627119 1:207613045-207613067 CTCCCACAGCAGAGGGCGGAGGG + Intronic
922255480 1:223889700-223889722 TTCCCGAAGGAGAAAGCTGCAGG - Intergenic
924336683 1:242992569-242992591 TTCCCGAAGGAGAAAGCTGCAGG - Intergenic
1065280743 10:24135182-24135204 CTCCAAGAGGAGAAGGAGGATGG + Intronic
1067349550 10:45463493-45463515 CTGCTGGAAGAGAAGGCGGATGG - Exonic
1070314034 10:75294365-75294387 CGCCCAAAGAAGAGGGCGGACGG + Intergenic
1072605725 10:96980946-96980968 CTCCCGAATCAGAAGGCTGCAGG - Intronic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1075118659 10:119648423-119648445 CTCCAGAAGGAGTAAGCTGAGGG + Intergenic
1076246347 10:128950283-128950305 GTCCTGAAGAAGAAGGAGGACGG + Intergenic
1076437939 10:130459388-130459410 TTCCCCAAGGTGAAGGGGGAGGG + Intergenic
1076679735 10:132165553-132165575 CTCCGGAAGGATGAGGCAGAAGG - Intronic
1076880729 10:133238023-133238045 CTCCCCAGGGAGAAGTCGGCAGG - Exonic
1081907190 11:46677552-46677574 CTCCCCAAGGACAAGGCTGCAGG + Exonic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1088390806 11:109312816-109312838 CTCTCAGAGGAGAAGGCCGAGGG + Intergenic
1090028247 11:123185636-123185658 CTCCCCCAGGGGAAGGCAGATGG + Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1092871284 12:12808004-12808026 CTCCAGAAGGAGAGGTCGAAGGG - Intronic
1095951808 12:47785669-47785691 CTACCCAAGGAGCAGGCAGATGG - Intronic
1096718380 12:53504377-53504399 CTCCTGAAGGAAAAGGCACAGGG - Exonic
1097100056 12:56581376-56581398 CTGCCGAGAGAGAAGGCAGATGG - Intronic
1102256631 12:111418918-111418940 CTCCCCAGGGTGAAGGCGAAGGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1113885952 13:113658477-113658499 CTCCTGAAGGAGAGGAGGGAAGG - Intergenic
1115197713 14:30819562-30819584 ATCCCAAAGGAGAAGGGGAAGGG - Intergenic
1119646281 14:76350827-76350849 CTGCCGAAGGACAGGGCAGAGGG - Intronic
1121510760 14:94511616-94511638 CTTCCAAAGGAGAAGTCGAATGG - Intronic
1122068108 14:99187776-99187798 CTCCAGGAGGAGGAGGAGGAAGG - Intronic
1122847309 14:104506908-104506930 CTCCCTCAGGAGAGAGCGGAGGG + Intronic
1124173097 15:27395055-27395077 CTCCAGAAGGAGAGGGCAGAGGG - Intronic
1124810926 15:32937301-32937323 CTCCCAAAGGAGAAGCCAGGAGG + Intronic
1125748109 15:42011110-42011132 TCCCCGAAGAACAAGGCGGAAGG - Intronic
1128347510 15:66863849-66863871 CTACTGAAGGAGGAGGCAGAGGG - Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129728433 15:77915892-77915914 CTCCCGAAGGAGAAGGCAGATGG - Intergenic
1130996856 15:88908893-88908915 CTCCAGAAGGAGGGGGCGGGGGG - Intronic
1132847036 16:2005435-2005457 CTCCCGAAGCAGCAGGCAGGCGG + Intronic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1135671857 16:24382267-24382289 CTCCTGGTGGAGAAGGAGGAGGG - Intergenic
1136427453 16:30178588-30178610 TTCTCCATGGAGAAGGCGGAGGG + Intergenic
1141703869 16:85654335-85654357 CTCCCTCAGGAGAAGGCAGGGGG + Exonic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144062739 17:11598526-11598548 CTCGCGGCGGAGAACGCGGATGG + Exonic
1145049473 17:19648477-19648499 ATCCTGGAGGAGCAGGCGGAGGG - Intronic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1148337676 17:46852150-46852172 CTCCGCAGGGCGAAGGCGGAGGG - Intronic
1148442901 17:47721022-47721044 CCCCCGAGGGAGAGGGCGGGTGG - Intergenic
1149143793 17:53465639-53465661 CTCCCCAAGAAGATGGCAGAGGG + Intergenic
1149509005 17:57221920-57221942 TTCCTGAAGGAGAAGACAGATGG + Intergenic
1150112015 17:62509808-62509830 CTCACAAAGTAGAAGGCAGAAGG - Intronic
1156594076 18:38525802-38525824 CTCCCTAAGGAGTAGGCGTTAGG + Intergenic
1159488002 18:69091547-69091569 CTCACGTGGGAGAAGGTGGAAGG + Intergenic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160492285 18:79348471-79348493 GTCCCGTGGCAGAAGGCGGAGGG + Intronic
1160823013 19:1067097-1067119 CTCCCGAAGGCGGAAGCGGGGGG + Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1163178669 19:15583653-15583675 CCCGGGATGGAGAAGGCGGAAGG - Intergenic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1165814356 19:38632520-38632542 CTCCCCAAGGGGAAGGGGTAGGG + Intronic
1167246206 19:48374627-48374649 CTCCTGCATGAGAAGGCGCAGGG - Intronic
1167977906 19:53246073-53246095 CTTCAGAAGGCCAAGGCGGATGG + Intronic
1168144995 19:54415732-54415754 GTCCCGAGGGAGAAGGGGGCTGG + Intronic
1168236011 19:55063567-55063589 GTCCTGCAGGAGAAGGCGGCTGG + Intronic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
927601470 2:24445888-24445910 TTCCTGAAGGAGAAGACAGACGG - Intergenic
935112331 2:100104844-100104866 CTCCCGGAGGAGAAAGAGGCGGG - Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
936834084 2:116685899-116685921 CTCCCCAAAGAGAATGTGGAAGG + Intergenic
940888449 2:159011923-159011945 GTCCCCAAGAAGAAGGAGGAGGG + Intronic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
947914430 2:233822373-233822395 CTTCTGAATGAGAAGGTGGATGG - Exonic
1170942658 20:20862042-20862064 CTTCAGGAGGACAAGGCGGATGG - Intergenic
1173580812 20:44145254-44145276 CTCCCGAAGGTGCAGGCTGCTGG + Intronic
1175612271 20:60361605-60361627 CTCCTGAAGGACATGGGGGATGG + Intergenic
1175746937 20:61463613-61463635 GTCCTGGAGGAGAGGGCGGAGGG + Intronic
1176020781 20:62961428-62961450 CTCCCCAAGGAGCGGGCGCAGGG - Intronic
1176362059 21:6006177-6006199 CTCCAAAAGGAGGAGGAGGAGGG + Intergenic
1176450665 21:6858717-6858739 CCCCCGGAGGAGACGGGGGACGG - Intergenic
1176828835 21:13723735-13723757 CCCCCGGAGGAGACGGGGGACGG - Intergenic
1178985888 21:37302751-37302773 CTCTGGGAGGACAAGGCGGATGG - Intergenic
1179761459 21:43532368-43532390 CTCCAAAAGGAGGAGGAGGAGGG - Intronic
1180074645 21:45456362-45456384 AGCCCAGAGGAGAAGGCGGAGGG - Intronic
1181486121 22:23232709-23232731 CACCTGAAGGAGGAGGCAGATGG - Intronic
1185079781 22:48703331-48703353 CACCTGAAGGAGAAGAAGGAAGG - Intronic
949706664 3:6826213-6826235 CACCTGAAGGAAAAGGGGGAGGG + Intronic
950357627 3:12425202-12425224 CCCCCGAAGGAGACGGGGAATGG + Intronic
950455026 3:13087817-13087839 CTCCCGTGGCAGAAGGTGGAAGG + Intergenic
950898623 3:16476190-16476212 CTCAAGATGGAGAAGGCAGAGGG + Intronic
952014768 3:28943219-28943241 CTTCCGAAGTTGAAGGAGGAAGG - Intergenic
954861919 3:53697305-53697327 CTCCTGAAGGAGTAGGAGTAGGG + Intronic
955736151 3:62040683-62040705 CTCTGGAAGGCCAAGGCGGACGG - Intronic
956750919 3:72343213-72343235 CTCCACCAGGAGAAGGCAGAGGG - Intergenic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
961954493 3:130787546-130787568 CACCCGCAGGAGAAGGAGGGTGG + Intergenic
962300027 3:134231648-134231670 CTTCCGAAGGATAAGGAGGTTGG - Intronic
962888302 3:139648443-139648465 CTCCTGAAGCAGGAGGCTGAAGG + Intronic
963003085 3:140701544-140701566 GTCCAGAAGGAGAAGAGGGAGGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
968082284 3:195854791-195854813 CCCAGGAAGGAGAAGGCCGACGG - Intergenic
968434209 4:576446-576468 CTCCGGGAGGAGGAAGCGGAGGG - Intergenic
968519183 4:1028039-1028061 CTCCCCAGGGAGTGGGCGGAGGG + Intergenic
969707335 4:8819078-8819100 CTCCCCAGTAAGAAGGCGGAGGG + Intergenic
971207330 4:24583833-24583855 CTCCAGACGGGAAAGGCGGAGGG - Intronic
974846215 4:67353513-67353535 CTCCCATAGCAGAAGGTGGAAGG + Intergenic
975986044 4:80202408-80202430 TTCCCGGAGGAGGCGGCGGAGGG + Exonic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
979240445 4:118442740-118442762 TTCCCGAAGGAGAAAGCTGCAGG + Intergenic
983301067 4:165926530-165926552 CTCAGGAAGCAGAAGGCAGAGGG + Intronic
985063673 4:186102072-186102094 CTCCTGAAGGAGAAGGGTGCTGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
987160809 5:15140230-15140252 CTCCTGAAGGAGAAGTCTCAGGG - Intergenic
989242748 5:39219447-39219469 CTCCTGCAGAAGAAGGCGGAAGG + Exonic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990992204 5:61697405-61697427 CCCCCTAAGGAGAAGGAGGTTGG - Intronic
995031423 5:107486297-107486319 CTCCTGAAGGAGAAGCCGGTAGG - Intronic
1000056228 5:157608914-157608936 TCCCCGAAGGAGAAGGGGAAGGG - Intergenic
1001169077 5:169400767-169400789 CTCACGTAGGAGAATGTGGATGG + Intergenic
1002740700 5:181433319-181433341 TTCCCGAAGGAGAAAGCTGCAGG + Intergenic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1004907743 6:20252448-20252470 CTCTGGGAGGACAAGGCGGATGG - Intergenic
1007651720 6:43426771-43426793 CTTCGGAAGGCCAAGGCGGACGG + Intergenic
1007947346 6:45838318-45838340 GTCCTGCAGGAGAAGGAGGAGGG - Intergenic
1010569831 6:77463449-77463471 CGGACGAAGGAGAGGGCGGAAGG + Exonic
1017794707 6:157833645-157833667 CTCCTGAGGGAGAAGGCACATGG - Intronic
1019212505 6:170418007-170418029 CTTCAGGAGGAGAAGGCGCATGG + Intergenic
1019455325 7:1123815-1123837 CTTCCGAGGGAGCTGGCGGAGGG - Intronic
1023016343 7:35971605-35971627 CTCCCGAAGGCGGCGGCGCAGGG - Intergenic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1025036187 7:55593848-55593870 CTCCCGAAGCAGGAAGCGGGAGG - Intergenic
1028862644 7:95670917-95670939 CACCTGGAGGAGAAGGCGAATGG - Intergenic
1028924028 7:96338121-96338143 CTCCCGAAGGAAAAGGAGAATGG + Intergenic
1029625758 7:101719234-101719256 CGCCAGGATGAGAAGGCGGAGGG + Intergenic
1032041210 7:128563718-128563740 CTCACAAAGTAGAAGGCAGAAGG - Intergenic
1032075079 7:128832292-128832314 TTCCAGAAGGACAAGGCTGAGGG + Intronic
1034257258 7:149731436-149731458 CTCCGGCAGGAGGAGGCGGCTGG - Intronic
1034441623 7:151088592-151088614 CTCCAGAAGGAGCTGGGGGAAGG - Intronic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035502314 8:99283-99305 TTCCCGAAGGAGAAAGCTGCAGG - Intergenic
1035652809 8:1281595-1281617 CTCCCCAATGAGAATGAGGACGG - Intergenic
1035739303 8:1914190-1914212 CTCCTGAAGTAGAAGGCAGCAGG + Intronic
1037826219 8:22162199-22162221 CGCCCGGTGGAGAAGGAGGAAGG + Intronic
1040751863 8:50719345-50719367 CTCCCGTGGCAGAAGGAGGAAGG - Intronic
1047732410 8:127737834-127737856 CACCTGAAGGAGAAGGCGAGAGG - Intronic
1048010024 8:130448037-130448059 CTGCTGAAGGAGAGGGCCGAAGG + Intergenic
1049193038 8:141299274-141299296 CTACGGAAGGAGAAAGCGGACGG + Intronic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1052975751 9:34408672-34408694 CTCCCCAAGGAGAGAGAGGAGGG - Intronic
1053047072 9:34928646-34928668 CTCCCATAGGAGAAGGGAGAGGG - Intergenic
1056126279 9:83538573-83538595 CAGCTGAAGGAGGAGGCGGAGGG + Intergenic
1056629773 9:88283679-88283701 CTCCAGCAGGTGAAGGCTGAGGG - Intergenic
1057259508 9:93576240-93576262 CTGCCGGGGGAGAAGGCGGGTGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1060679561 9:125549656-125549678 ATACACAAGGAGAAGGCGGAGGG - Intronic
1062408822 9:136411030-136411052 CTCCTGAAGGAGCACGCGGTAGG - Intronic
1203518517 Un_GL000213v1:25800-25822 CCCCCGGAGGAGACGGGGGACGG + Intergenic
1203606008 Un_KI270748v1:58126-58148 TTCCCGAAGGAGAAAGCTGCAGG + Intergenic
1189504147 X:41594307-41594329 CTCCCGAACAAGAAGGAGAAGGG - Intronic
1194790632 X:98145070-98145092 CTCCCAAAGGAGGAGGGAGAGGG - Intergenic
1197613123 X:128660808-128660830 CTCCTGAAGGAGAAGTCTCAGGG + Intergenic
1197827888 X:130610194-130610216 CTCACAAAGCAGAAGGCAGAAGG - Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1201489100 Y:14522814-14522836 TTCCCGAAGGGGAAGGCGCCTGG + Intronic
1202388174 Y:24344563-24344585 TTCCCGAAGGAGAAAGCTGCAGG + Intergenic
1202482613 Y:25325565-25325587 TTCCCGAAGGAGAAAGCTGCAGG - Intergenic