ID: 1129402860

View in Genome Browser
Species Human (GRCh38)
Location 15:75294389-75294411
Sequence GAACCCTCCCTGGCCACTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 5, 2: 21, 3: 29, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129402860 Original CRISPR GAACCCTCCCTGGCCACTCC TGG (reversed) Exonic
900527767 1:3137484-3137506 CACCCCTCCCTGGACACTCAAGG + Intronic
900651065 1:3730309-3730331 TAGCCCTCTCTGCCCACTCCTGG + Intronic
900989729 1:6092787-6092809 GAATCCTCTCTGTCCCCTCCTGG - Intronic
901115190 1:6838079-6838101 GAACAGTCCCTGGACACTCCAGG - Intronic
901153765 1:7122067-7122089 GAACACTCCATGGCCTTTCCCGG - Intronic
901204844 1:7488314-7488336 GAGCCATCCCTGGCCACTCCAGG - Intronic
901282646 1:8051182-8051204 GAATCCTTCCTGGCCTCTTCTGG + Intergenic
902617170 1:17630123-17630145 GGGCCCTCCCTGGACAGTCCTGG + Intronic
902691175 1:18110774-18110796 GAACCGTGCCTGGGCACTTCTGG + Intronic
902702630 1:18183024-18183046 GAAGCCACCCTGCCCCCTCCTGG + Intronic
903168915 1:21540228-21540250 GACCCCTGCCTGGGCACTGCAGG + Intronic
903356936 1:22754118-22754140 GGACCCTCTGTGGCCACCCCAGG + Intronic
904565545 1:31426119-31426141 GACCCCTCCAAGGCCTCTCCAGG - Intronic
905243572 1:36596907-36596929 CACCCCTCCCTGCCTACTCCAGG + Intergenic
905809058 1:40898808-40898830 GGACAGTCCCTGCCCACTCCGGG + Intergenic
906677409 1:47703008-47703030 GAGCCCTCCCTGCCCCCACCTGG - Intergenic
906771218 1:48486547-48486569 GAACCAGCCCTGCCCACACCTGG + Intergenic
908194861 1:61738771-61738793 GCTGCCTCCCTGGCCACCCCAGG - Intergenic
910488815 1:87745811-87745833 AGACCCTCCCTGGGCTCTCCAGG + Intergenic
911563645 1:99436240-99436262 GTACCCTCCTTCCCCACTCCAGG + Intergenic
912226832 1:107743307-107743329 GAACTCTCCCTTGCCACCCCTGG - Intronic
913215021 1:116612937-116612959 AAACCCTCCCTGGCTTCTCTTGG - Intronic
913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG + Intergenic
917931934 1:179828621-179828643 CAGCCCTGCCTGGCCACTCAGGG - Intergenic
918423565 1:184387046-184387068 GCTCGCTCCCTGCCCACTCCCGG + Exonic
920052707 1:203173263-203173285 GAAGCCTTCCTGGCACCTCCAGG + Intronic
921579086 1:216874124-216874146 GACCTCTCCCTGTCCACTTCTGG + Intronic
922346239 1:224699134-224699156 GCACCATCCCTGGACATTCCCGG + Intronic
922721356 1:227901763-227901785 GAACTCTGCCTGGACCCTCCTGG - Intergenic
923050883 1:230390609-230390631 CATCCCTACCTGCCCACTCCAGG + Intronic
1062860232 10:804949-804971 GAACCCTGCCTCTCCTCTCCCGG + Intergenic
1062923589 10:1297917-1297939 GAACCAGCCCTGCCCACACCTGG + Intronic
1063120289 10:3101133-3101155 GCACCCTCCCTGGCTCCTCCTGG + Intronic
1064121354 10:12622714-12622736 AAAGCCTCCCGGGCCGCTCCAGG - Intronic
1065670746 10:28113985-28114007 TGGCCCTCCCTGGCCACTCCTGG - Intronic
1065917272 10:30364561-30364583 CAACCCTCCCTGGCCTCTCCTGG + Intronic
1067228448 10:44390413-44390435 GAAGCCTCCATGCCCTCTCCAGG + Intergenic
1072221974 10:93334372-93334394 GAAACCTCCCTGACTGCTCCTGG + Intronic
1072724818 10:97806154-97806176 GACCCAGCCCTGGGCACTCCTGG + Intergenic
1072859850 10:98991922-98991944 AAACCCTCCCTGACCATTCTAGG + Intronic
1073812258 10:107164331-107164353 GAGCCCTGCCTGGCCGCCCCTGG + Exonic
1074078811 10:110151862-110151884 GACCCCTCCCAGGCCACAGCTGG - Intergenic
1074188375 10:111115739-111115761 GACCCCTCCCAGGCCACCTCAGG + Intergenic
1074520843 10:114222360-114222382 GCTTCCTCCCTGCCCACTCCCGG + Intronic
1076471190 10:130719436-130719458 GACCCCTTCGAGGCCACTCCTGG - Intergenic
1076794315 10:132791326-132791348 GAAACCTCCTTGGCCAGGCCAGG - Intergenic
1076841951 10:133050135-133050157 CCACCCTCCCTGGCCCTTCCTGG + Intergenic
1077297292 11:1832170-1832192 GAACCCTCCCTGGTCACCCCAGG - Intronic
1077370889 11:2181131-2181153 GACACCTCCCTGGCCGCCCCTGG - Intergenic
1077435489 11:2536836-2536858 GAACCAGCCCTGCCCACACCTGG - Intronic
1079114987 11:17635024-17635046 GGAACCTGCCTGGCCACCCCTGG - Intronic
1080566678 11:33516055-33516077 GAACCCTTCCCTGCCAATCCAGG + Intergenic
1083262483 11:61530744-61530766 GAAACCTACCTGGCCAGCCCAGG - Intronic
1083877040 11:65529701-65529723 GACCCCTGCCTGGCCACTCTTGG + Intronic
1084041063 11:66542985-66543007 GGAACCTCCCCGGCTACTCCGGG - Intronic
1084405089 11:68967397-68967419 GAAGGCGCCCTGGCCACTTCTGG - Intergenic
1084434560 11:69131323-69131345 GAACCTTTCCGGGCCACCCCTGG - Intergenic
1084490356 11:69475133-69475155 TACCCCTCCCTGGCCACCTCTGG - Intergenic
1088679360 11:112226206-112226228 CCACCCACCCTGACCACTCCAGG + Intergenic
1089644493 11:119869684-119869706 GAGCCCACCCTGGCCTCCCCTGG + Intergenic
1091043378 11:132303318-132303340 GAACCCTCCCTCGCCTCTCCTGG + Intronic
1092251046 12:6897132-6897154 GAACCCACCTGGGCCACTCTTGG + Intronic
1092513523 12:9184147-9184169 GCACCCTGCCTTGCCACTGCTGG + Intronic
1094484852 12:30916562-30916584 AAGCCCTCCCTGGCCTCTCTAGG - Intergenic
1097165696 12:57085329-57085351 GCCACCGCCCTGGCCACTCCTGG + Intronic
1101060129 12:100962535-100962557 GATCCCTCCAAGGCCACCCCAGG + Intronic
1101839336 12:108316628-108316650 GGCCCCTCCCTGCCCACACCGGG - Intronic
1103541544 12:121669666-121669688 GGCCCCTCCCTTGCCTCTCCTGG + Intronic
1103901799 12:124307285-124307307 GAACCCTGGCTGCCCACTGCTGG + Intronic
1103909862 12:124346295-124346317 GAAGCCTGCCTGGCCTCTCTGGG + Intronic
1104139235 12:125971707-125971729 AAAGCCTCCCTGGTCTCTCCAGG - Intergenic
1105218752 13:18306414-18306436 AAACCCTCCCTGGCTTCTCTTGG - Intergenic
1106140604 13:27007663-27007685 GAAGCCTCCCTGTCCCCTCCAGG - Intergenic
1107014112 13:35695245-35695267 GTTCCCTCTCTGGCCCCTCCCGG + Intergenic
1107453940 13:40537179-40537201 GAAGCTTCCTTGACCACTCCTGG + Intergenic
1107821450 13:44289332-44289354 GAAACTTCCCTTGCCTCTCCCGG + Intergenic
1118018869 14:61690221-61690243 TCACCATCCCTGGCCAGTCCAGG + Intergenic
1118722944 14:68607483-68607505 GACCCCTCCCTTGCCAGCCCAGG + Intronic
1119732917 14:76962493-76962515 GAACCCTCCCTGGCTCCCCAGGG - Intergenic
1120194031 14:81463741-81463763 GAACCCTTCCTGACCTCTTCCGG + Intergenic
1121280096 14:92691881-92691903 GAGGGCTCCCTGGCCTCTCCTGG + Intergenic
1122384011 14:101331683-101331705 GATCTGTCCCTGGCCTCTCCCGG + Intergenic
1122850492 14:104525821-104525843 GCACCCTGCCTGGCCAGGCCGGG + Intronic
1124199466 15:27665949-27665971 GATCTCTCCTTGGCCAGTCCGGG - Intergenic
1125788263 15:42341930-42341952 GAAACTTCCCTGACCACTCCTGG + Intronic
1125894194 15:43288179-43288201 GAGCCCACCCTGGCTCCTCCAGG - Intronic
1128921185 15:71611677-71611699 AAACCTTTCCTGGCCACCCCAGG - Intronic
1129038740 15:72666256-72666278 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129211150 15:74070974-74070996 GAACCCTCCCTGGCCGCTCCTGG + Exonic
1129399253 15:75270113-75270135 GAACCCTCCCTGGCCGCTCCTGG - Exonic
1129402860 15:75294389-75294411 GAACCCTCCCTGGCCACTCCTGG - Exonic
1129476395 15:75786810-75786832 GAACCCTCCCCGGCCGCTCCCGG - Intergenic
1129728283 15:77915248-77915270 GAACCCTCCCTGGCCGCTCCTGG + Intergenic
1130259246 15:82342965-82342987 GAACCCTCCCTGTCCTCTCCCGG + Intronic
1130269430 15:82436200-82436222 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130275993 15:82476631-82476653 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130282019 15:82526218-82526240 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130468354 15:84204023-84204045 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130473388 15:84242381-84242403 GAACCCTCCCTGTCCTCTCCCGG - Intronic
1130480802 15:84356445-84356467 GAACCCTCCCTGTCCTCTCCCGG - Intergenic
1130485394 15:84395733-84395755 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130490910 15:84431314-84431336 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130495912 15:84469519-84469541 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1130502494 15:84510113-84510135 GAACCCTCCCTGTCCTCTCCCGG + Intergenic
1130590647 15:85208621-85208643 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1130595665 15:85246959-85246981 GAACCCTCCCTGTCCTGTCCCGG - Intergenic
1130851664 15:87800743-87800765 GTACCTTCCCTGCCCAGTCCTGG + Intergenic
1131188724 15:90295600-90295622 GAACCCTCCCTGGCCTCTCCTGG - Intronic
1132715468 16:1288042-1288064 GAACCAACCCTGCCCACGCCTGG + Intergenic
1132829572 16:1920712-1920734 GAACCCTCCGAGCCGACTCCTGG - Intergenic
1132887973 16:2190777-2190799 CCAGCCTCCCTGGCCACCCCCGG - Intronic
1135501068 16:22996304-22996326 GAATCCTTCCTGGCCTCTGCTGG + Intergenic
1135587104 16:23679639-23679661 GACTCCTCCCTGGGTACTCCAGG - Intronic
1136861488 16:33707036-33707058 GAGCCCTTCCTGACCAGTCCCGG + Intergenic
1139390945 16:66605821-66605843 GACCTCTCCCTGGTCACTCAGGG + Intronic
1139588831 16:67921707-67921729 GAACCTTCCAGGGCTACTCCAGG + Intronic
1140230921 16:73116466-73116488 GCACCCTCCCCAGCCACTTCTGG - Intergenic
1141490301 16:84368230-84368252 GACCCCTCCCTGCCCAGTCACGG - Intergenic
1141576127 16:84964445-84964467 GGAGCCTCCCTGGTCACCCCTGG - Intergenic
1142144701 16:88487986-88488008 GAGCTCTCCCTGGCCAGTCCCGG + Intronic
1143152400 17:4815742-4815764 GAACCCTCCATGCCTGCTCCAGG + Exonic
1144488435 17:15686832-15686854 AAACCCTTTCAGGCCACTCCTGG - Intergenic
1144627166 17:16849885-16849907 AAACCCTCCCTGGCCTCTATGGG + Intergenic
1144879271 17:18422827-18422849 AAACCCTCCCTGGCCTCTATGGG - Intergenic
1145152966 17:20521560-20521582 AAACCCTCCCTGGCCTCTATGGG + Intergenic
1145937944 17:28726157-28726179 GATCCCTCTCGGGCCAGTCCAGG + Exonic
1147556248 17:41481024-41481046 GAGCCCCCACTGGCCCCTCCTGG + Exonic
1147571967 17:41576885-41576907 GGTCCCTCCCTGGCCCCACCTGG - Intergenic
1148643275 17:49204163-49204185 GTACCTTTCCTGGCCACACCAGG - Intronic
1148834383 17:50458124-50458146 GATCCCTCCCTTGTCCCTCCAGG - Intronic
1149690855 17:58574956-58574978 CAAGCCTCTCTGGCCTCTCCTGG - Intronic
1149815091 17:59715540-59715562 GGACCCTCCCTGGACACATCGGG + Intronic
1151678618 17:75612798-75612820 GAACCGTCCCTGCCCAGGCCAGG + Intergenic
1151943193 17:77305490-77305512 GAAGCCTCCCTGGTTACTCCAGG + Intronic
1152239961 17:79155991-79156013 AGAACCTCCCTGGCCCCTCCAGG + Intronic
1152240461 17:79158198-79158220 GAACCAACCCTGCCCACACCTGG + Intronic
1152569312 17:81114742-81114764 GAACCCTGCCTGCCCACCCCAGG + Intronic
1154135629 18:11775258-11775280 GAAACCCTCCTGGCCACCCCTGG - Intronic
1157579046 18:48762929-48762951 GAGCCCTCCCTGGCCAGCCTGGG + Intronic
1160498848 18:79392455-79392477 GGTTCCTGCCTGGCCACTCCGGG + Intergenic
1160850061 19:1186500-1186522 GATCCCTGCCTGGCCAATCTGGG - Intronic
1161157513 19:2740230-2740252 GAACCGTTCCTCGCCAATCCGGG - Intergenic
1161772155 19:6236719-6236741 GACCCCTTCCTGGCTACCCCTGG + Intronic
1162520291 19:11175680-11175702 GAACACTCACTGGCCAAGCCTGG - Intronic
1162798554 19:13098964-13098986 GAAGCCTCCCCAGCCCCTCCTGG + Intergenic
1164945640 19:32290854-32290876 GAAGCCTCCTTGGGCACTCCAGG - Intergenic
1165053127 19:33155846-33155868 GCAGCATCCCTGGCCTCTCCTGG - Intronic
1165461281 19:35945557-35945579 AAGCCCTCCCTGACCACACCTGG - Exonic
1165711137 19:38011809-38011831 GATCCCTCTCTGGCCTCCCCAGG - Intronic
1166046389 19:40233224-40233246 GCACCCAGCCCGGCCACTCCTGG + Exonic
1166315658 19:41988163-41988185 GAACCCTCCCTGGGCAACCCTGG + Intronic
1167386296 19:49166081-49166103 GCATCCTCCATGGCCACTGCGGG - Exonic
927400159 2:22701928-22701950 AAACCCTCCCTGGCCCTTCCAGG - Intergenic
927862265 2:26567577-26567599 GAACCCTCCCTTCCCAAGCCTGG - Intronic
928999555 2:37332666-37332688 AGACCTTCCCTGTCCACTCCAGG + Intergenic
929940837 2:46332890-46332912 GAAACCTCCCTGGCCTCTTAAGG + Intronic
931103916 2:59033233-59033255 AAACCCTCCCTGCCCCCACCAGG - Intergenic
932781763 2:74563066-74563088 GTACCCTCTCTGGACATTCCAGG - Intronic
933764439 2:85697299-85697321 GAGCCCTACCTGGCCAGTCTTGG + Intronic
934773276 2:96921474-96921496 GTACCTTCCCTGGCCACTCCCGG + Exonic
935279046 2:101502094-101502116 GAGTCCTCCCTGGCTGCTCCTGG - Intergenic
936155743 2:110046551-110046573 GGACCCTCCCAGCTCACTCCAGG + Intergenic
936188945 2:110324882-110324904 GGACCCTCCCAGCTCACTCCAGG - Intergenic
937364171 2:121248946-121248968 GAGCCTTGCCTGGCCTCTCCTGG + Intronic
938026778 2:127956222-127956244 GAAGCTTCCATGGCCTCTCCAGG - Intronic
940059904 2:149553486-149553508 GGACCATCCCTGGGCACCCCAGG - Intergenic
941810214 2:169748201-169748223 GACGCCTGCCTGGCCACTTCAGG + Intronic
942064350 2:172256277-172256299 GAAGCCTCTCTGGCTATTCCTGG - Intergenic
947530336 2:230905074-230905096 GAGCCCTCCTTAACCACTCCAGG + Intergenic
948661423 2:239508919-239508941 CGACCCTCCCTGGCCTCTCCTGG + Intergenic
1168804004 20:662327-662349 GAACCTTCCCCTGCCACTCCAGG - Exonic
1169651956 20:7878650-7878672 GAACTCTCCATGGTCATTCCTGG - Intergenic
1170763632 20:19272940-19272962 GAAGCCTTCCTGGACCCTCCAGG - Intronic
1172061999 20:32193032-32193054 GATCCCACCCTGGCCTCTCCTGG - Exonic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173539200 20:43838639-43838661 GAGCCCTCCTTGTCCAGTCCAGG - Intergenic
1174766997 20:53263934-53263956 GAACCCTCCCGGCCAAGTCCTGG - Intronic
1175856383 20:62122906-62122928 GAACCCACCCAGGGCACACCCGG + Intronic
1175994356 20:62805435-62805457 GAAGCCTCCCAGGCCAGACCCGG - Intronic
1176041212 20:63066804-63066826 GACCCCTCCCTGACCTCTCTAGG + Intergenic
1179246202 21:39636402-39636424 GATCCCTCCCTGGCTTCTCCTGG - Intronic
1179991821 21:44952326-44952348 GCAGCTTCCCTGGCCACTCAGGG + Intronic
1181043642 22:20204532-20204554 GAAGCGTCCTTGGCCACCCCTGG - Intergenic
1181496440 22:23289776-23289798 TAACCCACCTTGTCCACTCCTGG - Intronic
1181639449 22:24188999-24189021 GAGGCCTCCCTCGGCACTCCAGG + Exonic
1182415219 22:30217053-30217075 CCACCTCCCCTGGCCACTCCGGG + Intergenic
1182522926 22:30894510-30894532 GCAGGCTCCCTGGCCTCTCCTGG + Intronic
1183429082 22:37755022-37755044 GAACCCAGCCAGGCCACCCCAGG - Intronic
1183936430 22:41265045-41265067 GAGCCTTCCCGGGCCACTCCAGG - Intronic
1184101140 22:42342335-42342357 GTACCCACCCTGGAGACTCCAGG - Intronic
1184729682 22:46365689-46365711 CCACCCTCCCTGGCCTCTCTAGG - Exonic
1185184692 22:49391966-49391988 CGACCCTCCCTGGCCAGGCCGGG + Intergenic
950315432 3:11997953-11997975 CAGTCCTGCCTGGCCACTCCTGG - Intergenic
950329306 3:12143923-12143945 GAGCCTTCCTTGGCCACTCGAGG - Intronic
950570134 3:13794687-13794709 GAAGCATCCCTGGCCCCACCTGG - Intergenic
950899285 3:16482797-16482819 GCGCCCTCCCTGGCCTCTCTGGG - Intronic
951531849 3:23705377-23705399 GCACCCTCCCTGCCCACTCCTGG + Intergenic
952305676 3:32144026-32144048 CAACCCTCCCTGCCTAATCCAGG - Intronic
952951720 3:38531087-38531109 GCAGCCTCCCTGCCCACTGCTGG - Intronic
953413191 3:42701590-42701612 GTGCCCTCCCTGGCCCCGCCTGG - Intronic
953699662 3:45185893-45185915 GTCCCCTGCCTGGCCCCTCCGGG - Intergenic
954116090 3:48467571-48467593 GGACTATCCCTGGCCACACCTGG + Exonic
954407617 3:50354244-50354266 TGAGCCTCCCAGGCCACTCCGGG + Intronic
954436570 3:50499416-50499438 GAGCCCTCCCTGCCCACTAGAGG + Intronic
960121445 3:113951490-113951512 GCACCCTCCATGGCAGCTCCAGG - Intronic
961178893 3:124860590-124860612 GAAGCCTCCCTGGTCATTTCCGG + Intronic
962502466 3:136009234-136009256 GAACCCTTACTGCCCCCTCCAGG - Intronic
968943556 4:3651957-3651979 GCACCCTCCCTGGGGAATCCTGG + Intergenic
968964577 4:3763531-3763553 GACCCCTCCCTGGTCATGCCAGG + Intergenic
969161175 4:5260496-5260518 GAAGCCTCCCCGGTCATTCCAGG - Intronic
969293134 4:6253158-6253180 ACACCCTCCCTGGCCACCCTAGG - Intergenic
969900217 4:10342399-10342421 GGTCCCCACCTGGCCACTCCAGG - Intergenic
971029842 4:22624051-22624073 CAACCCTCACTGGCTTCTCCTGG - Intergenic
971439417 4:26664231-26664253 GAAGCCTCCCTTGACATTCCAGG - Intronic
972589080 4:40467174-40467196 GAACCCTCTCTGGACCCTGCAGG - Intronic
975627573 4:76364946-76364968 GATCTCTGCCTAGCCACTCCTGG + Intronic
981583436 4:146273692-146273714 AGCCCCTCCCTGGCCAGTCCTGG - Intronic
984342844 4:178481051-178481073 GAGCCCTCCCTGGCCAAACCTGG - Intergenic
984924771 4:184797062-184797084 GCTCCCTTCCTGCCCACTCCTGG + Intronic
985034637 4:185825957-185825979 GAAACATCCCAGGTCACTCCAGG + Intronic
985344963 4:188994555-188994577 GATCCCTTCCTCGCCCCTCCCGG + Intergenic
985788994 5:1915424-1915446 CCACCCTCCCTGGCCCCTGCAGG + Intergenic
985899872 5:2780114-2780136 GAACCGACCCTGCCCACACCTGG - Intergenic
985963859 5:3324811-3324833 GAACCCTTCCTGGCCCGTCACGG - Intergenic
986372874 5:7098374-7098396 AAACCTTTCCTGGCCACTCTGGG - Intergenic
986802261 5:11273957-11273979 GTCCCCTCCCTGGCCGCCCCAGG - Intronic
987038261 5:14038867-14038889 GAAACCTTCCTGGCCCCTCCAGG + Intergenic
987345579 5:16975942-16975964 GAGCCATGCCTGGCCAGTCCAGG - Intergenic
997978109 5:138452104-138452126 GCAGCCTCCCTGCCCGCTCCTGG + Intergenic
999231501 5:150064846-150064868 GAACCCTCCCCTGCCCCTGCTGG + Intronic
999239811 5:150120861-150120883 GTACCTTCCCTGGCCCCTGCAGG - Intronic
1002068788 5:176666060-176666082 GAGGCCTTCCTGGCCACTCTAGG + Intergenic
1002912526 6:1501242-1501264 CCACCCTCCCTGGCCTCTCGCGG - Intergenic
1003879435 6:10466684-10466706 GAATCCTTCCTCGCCTCTCCTGG + Intergenic
1004262924 6:14123989-14124011 AATCCCTTCCTGGCTACTCCTGG + Intronic
1004620426 6:17326231-17326253 AAATCCTCCTTGCCCACTCCAGG - Intergenic
1006375385 6:33668897-33668919 GACCCCTCCCTGAGCACACCCGG - Intronic
1007400275 6:41599150-41599172 GAACCCTCCGTGTCCTCTACTGG - Exonic
1007746181 6:44044148-44044170 GAACCTGCCATGGCCCCTCCAGG + Intergenic
1012978121 6:105801889-105801911 GAGCCCACCCTGACCCCTCCCGG + Intergenic
1013220496 6:108073918-108073940 GGATCCTTCCTGGCAACTCCAGG + Intronic
1013394145 6:109717604-109717626 AAATCTTCCCTGGCCATTCCAGG - Intronic
1015869352 6:137760416-137760438 CAACCATCCCTGTCCATTCCTGG - Intergenic
1017115669 6:150974298-150974320 CAATCCTTCTTGGCCACTCCTGG + Intronic
1018797241 6:167196102-167196124 GAACCTTCCCTGTCACCTCCGGG + Intronic
1018819056 6:167358662-167358684 GAACCTTCCCTGTCACCTCCGGG - Intronic
1019134518 6:169899788-169899810 GGACCCTGCCTGGCCACCCTGGG - Intergenic
1019148917 6:169991359-169991381 GAACCAGCCCTGCCCACTTCTGG + Intergenic
1019291282 7:251750-251772 GCAGCTTCCCTGGCCACTCCTGG + Intronic
1019506208 7:1392791-1392813 GAGCCCACTCTGGCCACTGCAGG + Intergenic
1019662549 7:2232799-2232821 GGCCCCTCCCTTGCCATTCCCGG + Intronic
1020125212 7:5529700-5529722 GCCCCCGCCCTGGCCACTTCCGG + Intronic
1022193134 7:28036746-28036768 TAACCCTGCCTGGGCACTCAGGG + Intronic
1024237211 7:47407836-47407858 GAAACCACCCTGCCCACACCTGG + Intronic
1024273672 7:47660299-47660321 GAACCCCACCTGCCCACCCCAGG - Exonic
1024674298 7:51624149-51624171 GAAGCCTTCCTGGCCATTCCAGG - Intergenic
1025996425 7:66530213-66530235 CAACCCCGCCTGGCCACCCCAGG - Intergenic
1026988442 7:74569442-74569464 CAACCCCACCTGGCCACCCCAGG - Intronic
1030083484 7:105797747-105797769 GAAGCCTCCCTCTCCCCTCCTGG + Intronic
1030335811 7:108324619-108324641 GAAGCCTCCCTGTCCAGTCGGGG + Intronic
1032785029 7:135194002-135194024 GAACCCTTCCTTCCCACTCTTGG + Intronic
1034585682 7:152090177-152090199 AAACTGTCCCTGGTCACTCCTGG - Intronic
1035333581 7:158112080-158112102 GAACCAGCCCTGCCCACACCTGG + Intronic
1036789852 8:11710135-11710157 GAACCTTCCCTGGCCACCCAGGG - Intronic
1037796540 8:22000135-22000157 GAACCCTCCCTGGCTAACCAGGG - Intronic
1037974471 8:23199936-23199958 GGCCCCTCCCTGGCCACTAAGGG - Intronic
1039916635 8:41865110-41865132 GAGGCCTCCCTGGCCACCCAAGG + Intronic
1042815650 8:72875290-72875312 GAACCCTCCCTTGCTCCTGCAGG + Intronic
1044263772 8:90158921-90158943 CACCCCTACCTGCCCACTCCTGG - Intergenic
1047517685 8:125569360-125569382 CAACTCTCCCTGGCCAGTCTTGG + Intergenic
1047763145 8:127968911-127968933 AAACCCTTCCTTGCCTCTCCTGG - Intergenic
1048491098 8:134894658-134894680 GAATCCTCCCTGACTACTCATGG + Intergenic
1049303398 8:141883768-141883790 GAGCCCTCCCTGGCCGCCCAGGG + Intergenic
1049403628 8:142442044-142442066 GGACCATGCCTGGCCACTTCTGG + Intergenic
1049488129 8:142876965-142876987 TCCCCGTCCCTGGCCACTCCAGG + Intronic
1049493012 8:142914988-142915010 TCCCCATCCCTGGCCACTCCAGG + Intronic
1049569580 8:143362863-143362885 TTCCCCTCCCTGGCCACTCTGGG + Intergenic
1049709831 8:144058460-144058482 GCACCCCCACTGCCCACTCCTGG - Intronic
1050975683 9:11935379-11935401 GCACCCTCCCCTCCCACTCCAGG - Intergenic
1053322004 9:37106993-37107015 GAACCCTCCCTGCCTCTTCCTGG - Intergenic
1055066584 9:72125252-72125274 GATCCTTCTCTGGCCTCTCCAGG - Intronic
1056835421 9:89951272-89951294 GAGCCCACCCTCCCCACTCCTGG - Intergenic
1059311607 9:113392110-113392132 GTCTCCTACCTGGCCACTCCTGG + Exonic
1060779421 9:126400601-126400623 GTGCCCTCCCTGCCCACTGCAGG - Intronic
1061014047 9:127971798-127971820 GAAGCCTCCCTGGCCTCTTTTGG - Intronic
1061118655 9:128629867-128629889 GAACCTTGCCGGGACACTCCAGG + Intronic
1061352760 9:130078826-130078848 GAACTGTCACTGGCCCCTCCTGG + Intronic
1061373667 9:130211932-130211954 GAAGCCTCTCTGACCACCCCAGG - Intronic
1061538763 9:131266100-131266122 GGACTCTCCCTCGCCCCTCCAGG + Intronic
1061711450 9:132490640-132490662 TTACCCTCCCTGGCTACTCCTGG + Intronic
1061943272 9:133894255-133894277 GCACCATCCCTGGCCAGGCCGGG - Intronic
1062042485 9:134410543-134410565 CAAGCCTCCCTGCCCACACCAGG - Intronic
1062046473 9:134426779-134426801 CCACCATCCCTGGCCAGTCCTGG - Intronic
1062055487 9:134467754-134467776 CCATCTTCCCTGGCCACTCCAGG - Intergenic
1062338046 9:136081155-136081177 GGACCCTCAGTGGCCACTCGGGG + Intronic
1062703259 9:137919177-137919199 GAAACCTCTGTGGCCCCTCCTGG - Intronic
1185571238 X:1136534-1136556 GAACCAGCCCTGCCCACACCTGG - Intergenic
1185606353 X:1369224-1369246 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606478 X:1369926-1369948 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606561 X:1370388-1370410 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606606 X:1370622-1370644 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606688 X:1371089-1371111 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606731 X:1371321-1371343 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606774 X:1371553-1371575 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606818 X:1371787-1371809 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606863 X:1372021-1372043 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606904 X:1372256-1372278 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606947 X:1372488-1372510 GAACCAGCCCTGCCCACACCTGG + Intronic
1185606990 X:1372720-1372742 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607034 X:1372954-1372976 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607079 X:1373188-1373210 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607121 X:1373418-1373440 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607202 X:1373888-1373910 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607330 X:1374587-1374609 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607413 X:1375051-1375073 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607458 X:1375285-1375307 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607501 X:1375517-1375539 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607546 X:1375751-1375773 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607591 X:1375985-1376007 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607634 X:1376215-1376237 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607716 X:1376685-1376707 GAACCAGCCCTGCCCACACCTGG + Intronic
1185607762 X:1376917-1376939 GAACCAGCCCTGCCCACACCTGG + Intronic
1185609969 X:1388444-1388466 GAACCAGCCCTGCCCACACCTGG + Intronic
1185610037 X:1388898-1388920 GAACCAGCCCTGCCCACACCTGG + Intronic
1185618346 X:1436954-1436976 GAACCAGCCCTGCCCACACCTGG - Intronic
1185618383 X:1437185-1437207 GAACCAGCCCTGCCCACACCTGG - Intronic
1185618415 X:1437418-1437440 GAACCAGCCCTGCCCACACCTGG - Intronic
1185627984 X:1495989-1496011 GAACCAGCCCTGCCCACACCTGG + Intronic
1185631115 X:1516387-1516409 GAACCAGCCCTGCCCACACCTGG + Intronic
1185663592 X:1746339-1746361 GAACCAGCCCTGCCCACACCTGG + Intergenic
1185672145 X:1821392-1821414 GAACCAGCCCTGCCCACACCTGG - Intergenic
1185682057 X:1897012-1897034 GAACCAGCCCTGCCCACACCTGG - Intergenic
1185726245 X:2424208-2424230 GAACCAGCCCTGCCCACACCTGG + Intronic
1185746094 X:2574681-2574703 GAACCAGCCCTGCCCACACCTGG + Intergenic
1185799337 X:2995654-2995676 GAACCAGCCCTGCCCACACCTGG - Intergenic
1185869621 X:3652932-3652954 GAACCAGCCCTGCCCACACCTGG + Intronic
1185873645 X:3684686-3684708 GAACCAGCCCTGCCCACACCTGG - Intronic
1186371675 X:8953252-8953274 GAACCAGCCCTGCCCACACCTGG - Intergenic
1188333513 X:28899440-28899462 GAACCGTGCCTGGCCATTCCTGG + Intronic
1193312656 X:80025840-80025862 AAAGCCTCCCTGGCCTCTCCAGG - Intronic
1195677857 X:107521136-107521158 GAGCCCTCCCTGTTCTCTCCTGG + Intergenic
1195689174 X:107609885-107609907 CCACCCTACCTGGCCATTCCAGG - Intergenic
1196825791 X:119739260-119739282 GAGCCCTGCCTGGCCTCGCCAGG - Intergenic
1196863877 X:120052759-120052781 GAAACCTCCCTTGCCATACCTGG + Intergenic
1196879222 X:120183571-120183593 GAAACCTCCCTTGCCATACCTGG - Intergenic
1198280159 X:135133730-135133752 GAACCATCCCTGCAGACTCCGGG + Intergenic
1198290799 X:135238784-135238806 GAACCATCCCTGCAGACTCCGGG - Intergenic
1199599662 X:149534428-149534450 GGACCCCCCCTGGCCGCTGCAGG - Intergenic
1200056716 X:153465437-153465459 GCACCCTCCCCGGCCTCGCCTGG + Intronic
1200967344 Y:9109249-9109271 GATCTCTCCCTGGCCACCCTTGG + Intergenic
1201579059 Y:15492303-15492325 CCACCCTCCCAGGCCGCTCCTGG + Intergenic
1202174046 Y:22081172-22081194 GATCACTCCCTGGCCACCCTAGG - Intronic
1202217314 Y:22505210-22505232 GATCACTCCCTGGCCACCCTAGG + Intronic
1202325872 Y:23690849-23690871 GATCACTCCCTGGCCACCCTAGG - Intergenic
1202367329 Y:24174284-24174306 GAACCCTCCCTGTCCTCTCCTGG - Intergenic
1202372742 Y:24209568-24209590 GCACCCTCCCTGTCCTCTCCTGG + Intergenic
1202498040 Y:25460552-25460574 GCACCCTCCCTGTCCTCTCCTGG - Intergenic
1202503452 Y:25495839-25495861 GAACCCTCCCTGTCCTCTCCTGG + Intergenic
1202544899 Y:25979205-25979227 GATCACTCCCTGGCCACCCTAGG + Intergenic