ID: 1129403601

View in Genome Browser
Species Human (GRCh38)
Location 15:75300483-75300505
Sequence CTGCCTGGGTGCCGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129403601_1129403608 14 Left 1129403601 15:75300483-75300505 CCTCTCCCACGGCACCCAGGCAG No data
Right 1129403608 15:75300520-75300542 AGACCAATGCTCAGCCCCCTCGG No data
1129403601_1129403609 15 Left 1129403601 15:75300483-75300505 CCTCTCCCACGGCACCCAGGCAG No data
Right 1129403609 15:75300521-75300543 GACCAATGCTCAGCCCCCTCGGG 0: 3
1: 4
2: 4
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129403601 Original CRISPR CTGCCTGGGTGCCGTGGGAG AGG (reversed) Intergenic
No off target data available for this crispr