ID: 1129405415

View in Genome Browser
Species Human (GRCh38)
Location 15:75313720-75313742
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129405405_1129405415 21 Left 1129405405 15:75313676-75313698 CCACTCTTGATCTGTCTTCTGGA No data
Right 1129405415 15:75313720-75313742 GGTCCCGGTGGGGCACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129405415 Original CRISPR GGTCCCGGTGGGGCACACGT GGG Intergenic
No off target data available for this crispr