ID: 1129407291

View in Genome Browser
Species Human (GRCh38)
Location 15:75328051-75328073
Sequence CCTCACAGGCAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129407291_1129407302 -6 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407302 15:75328068-75328090 GTGAGGTGGGTGGGGCCGGAAGG No data
1129407291_1129407303 -3 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407303 15:75328071-75328093 AGGTGGGTGGGGCCGGAAGGAGG No data
1129407291_1129407307 10 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407307 15:75328084-75328106 CGGAAGGAGGGACCACCTGTGGG No data
1129407291_1129407304 -2 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407304 15:75328072-75328094 GGTGGGTGGGGCCGGAAGGAGGG No data
1129407291_1129407300 -10 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407300 15:75328064-75328086 GCCTGTGAGGTGGGTGGGGCCGG No data
1129407291_1129407306 9 Left 1129407291 15:75328051-75328073 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129407306 15:75328083-75328105 CCGGAAGGAGGGACCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129407291 Original CRISPR CCTCACAGGCAGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr