ID: 1129411297

View in Genome Browser
Species Human (GRCh38)
Location 15:75352007-75352029
Sequence GGGTGCAAGGGGAAGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 467}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129411297_1129411307 18 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411307 15:75352048-75352070 CCCCTCTCCCCATCCCATGGAGG 0: 1
1: 0
2: 7
3: 51
4: 405
1129411297_1129411312 23 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411312 15:75352053-75352075 CTCCCCATCCCATGGAGGGTGGG 0: 1
1: 1
2: 0
3: 13
4: 183
1129411297_1129411313 24 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411313 15:75352054-75352076 TCCCCATCCCATGGAGGGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 220
1129411297_1129411309 19 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411309 15:75352049-75352071 CCCTCTCCCCATCCCATGGAGGG 0: 1
1: 1
2: 3
3: 85
4: 766
1129411297_1129411305 15 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411305 15:75352045-75352067 GAGCCCCTCTCCCCATCCCATGG 0: 1
1: 0
2: 7
3: 246
4: 3689
1129411297_1129411318 29 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411318 15:75352059-75352081 ATCCCATGGAGGGTGGGGATGGG 0: 1
1: 1
2: 2
3: 26
4: 303
1129411297_1129411311 22 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411311 15:75352052-75352074 TCTCCCCATCCCATGGAGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 244
1129411297_1129411317 28 Left 1129411297 15:75352007-75352029 CCAGTTTCCTTCCCCTTGCACCC 0: 1
1: 0
2: 1
3: 44
4: 467
Right 1129411317 15:75352058-75352080 CATCCCATGGAGGGTGGGGATGG 0: 1
1: 0
2: 3
3: 49
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129411297 Original CRISPR GGGTGCAAGGGGAAGGAAAC TGG (reversed) Intronic
900129368 1:1080984-1081006 GGGAGCAGAGGGAAGGAGACAGG - Intergenic
901421472 1:9154152-9154174 GGGTGCAAGAGGCAGGAATCTGG + Intergenic
901749554 1:11397463-11397485 GGCTGCAAGAGGAAGGGGACAGG - Intergenic
902468086 1:16630450-16630472 GGATGCAAGGGGGAGGAGCCTGG - Intergenic
902574173 1:17366826-17366848 GGGAGCAAGGCGAAAGGAACAGG - Intergenic
902672984 1:17987868-17987890 GGATGCAGGAGGAAGGACACAGG + Intergenic
903155053 1:21437225-21437247 GGATGCAAGGGGGAGGAGCCTGG + Intergenic
903282226 1:22256473-22256495 GGGTGGCAGGTGGAGGAAACTGG + Intergenic
904439986 1:30524022-30524044 GAGTGAATGGGGAAGGAAAGGGG + Intergenic
904500648 1:30910814-30910836 GGGTGCAATAGGTGGGAAACTGG + Intergenic
905933813 1:41807885-41807907 GGGGGCAGGGGGAAGGCATCAGG + Intronic
906058073 1:42931261-42931283 GGGTGCAAGGGGAAAGGAAAAGG - Intronic
906553382 1:46686235-46686257 AGGTACAAGGTGAAGGGAACTGG + Intronic
906796456 1:48700107-48700129 GGAGGCAAGGGGAAGGGAAAGGG - Intronic
907281030 1:53347123-53347145 GGGTGAAGGGAGAAGCAAACTGG + Intergenic
907924073 1:58939843-58939865 GGCTGCAGGGGGAAGGAGTCAGG - Intergenic
908171117 1:61505490-61505512 TGGGGGAAGGGGAAGGAAATGGG + Intergenic
908471508 1:64448485-64448507 GAGTGCAAGGGAAATGAAACAGG + Intergenic
908763228 1:67531360-67531382 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
909804516 1:79858238-79858260 GGGTGCAAGGTGCAGGAGGCGGG - Intergenic
910666923 1:89735437-89735459 TGGGGGAAGGGGCAGGAAACTGG - Intronic
911282702 1:95951437-95951459 GCATGCAAGGGGAAGGAAGAAGG - Intergenic
912875150 1:113350192-113350214 GGGAGCAAGTGCAAGGAACCTGG + Intergenic
914827923 1:151148819-151148841 AGGAGCAAGGGGAGGGAAAAGGG + Intergenic
914914041 1:151807378-151807400 GGGTTCATGGGAAAGGAAAAGGG + Exonic
915365262 1:155311589-155311611 GTGGGGATGGGGAAGGAAACTGG + Intronic
917805202 1:178607005-178607027 GGGTGCCATGGGAAGGAGCCTGG - Intergenic
918146361 1:181759430-181759452 GAGTGCAAGGGGAAGGATTCTGG + Intronic
918653877 1:186999990-187000012 GGATGGAAGGGGAGGGAAGCAGG - Intergenic
919056945 1:192583031-192583053 GGGAGAAAGGGAAAGGAAAAGGG + Intergenic
919138997 1:193546426-193546448 GGGGTAAAGGGGAAGGAATCAGG + Intergenic
919353136 1:196485303-196485325 GGGGGCGAGGGGAAGGAAAATGG + Intronic
919801698 1:201358329-201358351 GGGAGCCAAGGGAAGGAATCAGG + Intergenic
920295919 1:204956302-204956324 GGGTGCCAGGGAAAGGGATCTGG - Intronic
920313993 1:205065041-205065063 GGGTGGATGGGGGAGGAAATGGG - Intronic
920607002 1:207398822-207398844 GGGTACAAGGGGTAGAAAGCAGG - Intergenic
920868491 1:209773226-209773248 GGGTGCAAAGAGAAGGATACTGG - Intronic
921367821 1:214390815-214390837 GGGTCCAAGGGGGACAAAACGGG + Intronic
921800851 1:219400140-219400162 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
921874092 1:220174840-220174862 GGTTGCAAGTGGAAGGAACATGG - Intronic
922059532 1:222074518-222074540 GGGAGCTAGGGCAAGGACACAGG - Intergenic
922603765 1:226876023-226876045 GGGTGCAGGGGGTGGGAGACGGG + Intronic
922878551 1:228960891-228960913 GCGTGCAGGAGGAAGGAAGCAGG + Intergenic
923210976 1:231804068-231804090 ACAGGCAAGGGGAAGGAAACAGG + Intronic
923264655 1:232302590-232302612 GGGAGGAAGGGAGAGGAAACAGG + Intergenic
923359899 1:233200683-233200705 GAGGGCAAGAGAAAGGAAACTGG + Intronic
923751813 1:236753802-236753824 GGGTGTAGGGGGAAGGAAGAGGG - Intronic
924131635 1:240915267-240915289 AGGTGCAATGGGAAGGATAGAGG - Intronic
1065281301 10:24141369-24141391 GGGTCCAAGTGGTAGGAAAATGG - Intronic
1065343721 10:24728057-24728079 GAGGGCAAGGGAAAGGAAAGGGG + Intergenic
1065673401 10:28147073-28147095 AGGTGAAAGGGGAAAGAAAGAGG + Intronic
1065811944 10:29450625-29450647 GGGAGGGAGGGGAAGGAATCAGG - Intergenic
1067079094 10:43203553-43203575 GCCTGCAAGGCGAAGGGAACCGG - Intronic
1067142966 10:43671587-43671609 GGGCGCAAGGGGAAGGAAGGAGG - Intergenic
1068241041 10:54300900-54300922 GTGTGCAAGGGGACCCAAACAGG - Intronic
1068550306 10:58400428-58400450 GGGTGCATGGGGCAGGAGAGGGG + Intergenic
1069001067 10:63265510-63265532 GGTAGGAAGAGGAAGGAAACAGG + Intronic
1069287391 10:66732524-66732546 TGGTGGAAGGAGAAGCAAACAGG + Intronic
1069576680 10:69535650-69535672 GGGTGCCAGGGGCAGAAAGCTGG - Intergenic
1070596451 10:77835928-77835950 GGGAGCAAGGGGCAGGAAGAGGG + Intronic
1071148539 10:82604198-82604220 GGGTTCAGGGGGAAGGAGAGAGG - Intronic
1072081889 10:92041039-92041061 GGGTGCAATGGGAGGGAAGTGGG + Intergenic
1073769158 10:106716481-106716503 GGCAGCAGTGGGAAGGAAACAGG - Intronic
1074093142 10:110282577-110282599 GGGTACAAGGAGGAGGTAACAGG - Intronic
1074493817 10:113961063-113961085 GGGTGCAAGGAGCAGGGAGCAGG - Intergenic
1074524869 10:114254473-114254495 GGGTGGAAGAGGAAGGAATATGG - Intronic
1074978016 10:118596369-118596391 GGGTGTTTGGGGAAGGAACCTGG + Intergenic
1075122676 10:119675813-119675835 GGGGGAAGGGGGAAGGAAGCAGG - Intronic
1075479110 10:122764302-122764324 GGGCACAAGGGGAAGGGGACTGG - Intergenic
1075640498 10:124060911-124060933 GGGAGAAAGGGAAAGGAACCAGG + Intronic
1075724822 10:124605850-124605872 AGGGGGAAGGGGAAGGGAACAGG + Intronic
1076191691 10:128487733-128487755 GGCTGCAACTGGAAGGGAACAGG + Intergenic
1076279709 10:129235942-129235964 GGGTGCAAGATGAAGAAAAGGGG - Intergenic
1077075711 11:701033-701055 AAGGGCAAGGGGAAGGAAAGGGG - Intronic
1077396279 11:2324670-2324692 TGGTGGAAGGGGGAGCAAACAGG - Intergenic
1078757869 11:14228431-14228453 GGGAGGCAGGGGAAGGAAGCAGG + Intronic
1078881250 11:15450957-15450979 GAGTGCAAGGGGCAGGGAAGTGG + Intergenic
1079341249 11:19613383-19613405 TGGTGGTAGGGAAAGGAAACAGG - Intronic
1081299174 11:41429213-41429235 TGGTGGAAGGGGAAACAAACAGG - Intronic
1082195566 11:49300332-49300354 GGGGGAAAGGAGAAGGAAAAAGG + Intergenic
1082984601 11:59157741-59157763 GGGGCAAAGGGGAAGGAAATTGG - Intergenic
1084561360 11:69907287-69907309 AGGTGGAAGGGGCAGGTAACTGG + Intergenic
1085794977 11:79530960-79530982 AGGTGAAAAGAGAAGGAAACTGG - Intergenic
1085860809 11:80233046-80233068 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1086748665 11:90462510-90462532 GGGTGAAAGGGGCAGTAACCAGG + Intergenic
1086761209 11:90633948-90633970 TGGTGGAAGGGGAAGCAAAGAGG + Intergenic
1089709097 11:120302261-120302283 GGGTGAAAGGGGAGGGACAAAGG - Intronic
1089864587 11:121620599-121620621 GGGGGCAAGGGGAAAATAACAGG - Intronic
1090668680 11:128931073-128931095 GAGTGGAACAGGAAGGAAACAGG - Intergenic
1091265821 11:134270315-134270337 GGGTGAAAGGGGCAGGGAGCCGG - Intergenic
1091416841 12:295254-295276 AGGAGAAAGGGGAAGGAAAAAGG + Intronic
1091643594 12:2256093-2256115 GTGTGCAAGTGGCAAGAAACAGG - Intronic
1091671426 12:2454797-2454819 ACGTGAAAGGGGAAGGAGACGGG - Intronic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1093481914 12:19612689-19612711 GGGCTGAAGGGGAAGGAAGCTGG - Intronic
1095913568 12:47453650-47453672 GGGAGCAAGGTGAAAGGAACTGG + Intergenic
1096163824 12:49403686-49403708 GGGTACTAGGGGCAGGAAACAGG - Intronic
1097009330 12:55941114-55941136 GGAGGGAAGGGGAGGGAAACAGG + Intronic
1097997598 12:65906687-65906709 GGGTAGAGGGGGAAAGAAACAGG + Intronic
1099783839 12:87235851-87235873 GGATGGAAGGGGAAGGAATTAGG + Intergenic
1100427975 12:94504981-94505003 GAGGGGAGGGGGAAGGAAACTGG + Intergenic
1100817513 12:98400262-98400284 GTGTGCAAGGGGTAGGAACGTGG - Intergenic
1100921661 12:99494891-99494913 GGGAGCAAGAGGAAGGTTACAGG + Intronic
1101685911 12:107020618-107020640 TGGTGGAAGGGGAAGGGAAAGGG - Intronic
1102552589 12:113702422-113702444 AGATGCAATGGGAATGAAACAGG + Intergenic
1102612500 12:114124781-114124803 TGGTACAGAGGGAAGGAAACTGG - Intergenic
1103005869 12:117419623-117419645 GGGTGAAAGGGGTAGGAAGTAGG + Intronic
1103400353 12:120639707-120639729 ATGTGCAGGGGGAAGGGAACTGG + Intergenic
1103567782 12:121825489-121825511 GGGTGCAAGTGGAAGGGGAGAGG + Intronic
1103753978 12:123188506-123188528 AGGTTCAAGGGGAGGGAAAATGG - Intronic
1104123247 12:125819323-125819345 GGGGGGAAGTGGAAGGAAATTGG + Intergenic
1104234735 12:126922841-126922863 GGATGTAGGGGGAAGCAAACTGG - Intergenic
1104748217 12:131223050-131223072 TGGGGCAAGGGGAGGGAAAGTGG - Intergenic
1104876629 12:132039408-132039430 GGGAGCAAGGGGCAGGCAGCAGG + Intronic
1106101739 13:26699195-26699217 AGGTTCAAGGAGAAGGAAACAGG - Intergenic
1106471523 13:30060321-30060343 GGGAGCCAGGGGAATGAAAAAGG - Intergenic
1106995886 13:35478901-35478923 GGGTCCAACGGGAAGGACGCGGG + Intronic
1107968060 13:45615189-45615211 GAGAGGTAGGGGAAGGAAACAGG + Intronic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108726243 13:53184553-53184575 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1108856884 13:54803749-54803771 GGAAGCAAGGGGAAAGAAATAGG - Intergenic
1109909725 13:68893427-68893449 GGGTAAAAGGGGAAGGAGAGGGG - Intergenic
1110210091 13:72961649-72961671 GGGTGAAAGGGTAAGGAAGGGGG - Intronic
1112310155 13:98310962-98310984 GGGTTCATGGAGCAGGAAACAGG + Intronic
1112532740 13:100220663-100220685 GGGAGCAAGGAGAGGGAAATAGG - Intronic
1112665150 13:101561448-101561470 GGCAGCTATGGGAAGGAAACAGG + Intronic
1113084501 13:106554448-106554470 GAGAGGAAGGGGAAGGAAAAAGG + Intronic
1113409555 13:110072746-110072768 GGATGGAAGGGGAAGGAAGGGGG + Intergenic
1113574986 13:111389051-111389073 GGATGCCAGGGGAAGGACGCAGG + Intergenic
1113918295 13:113887944-113887966 GGGTGAATGGATAAGGAAACTGG - Intergenic
1114035829 14:18626586-18626608 GGATGAAAGGGCAAGGGAACTGG + Intergenic
1114122809 14:19688436-19688458 GGATGAAAGGGCAAGGGAACTGG - Intergenic
1114617627 14:24076637-24076659 GGGTGGAAGGGACAGGAAGCTGG - Intronic
1115119810 14:29926896-29926918 GGGAGAGAGGGGAAGAAAACTGG + Intronic
1115317575 14:32041150-32041172 GGGAAAAAGGGGAGGGAAACTGG + Intergenic
1115377496 14:32693828-32693850 GGGTGCAAGGAGAGAGAAATAGG + Intronic
1116050254 14:39794160-39794182 TGGTGGAAGGGGAAGCAAACAGG + Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1116397350 14:44462517-44462539 GGCTGCACTGGGAAGGAAGCAGG + Intergenic
1116419455 14:44716022-44716044 GGGAACAAGGGGGTGGAAACAGG - Intergenic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1118547134 14:66904248-66904270 GGGTGGAAGGGGAATCAAGCAGG + Intronic
1119232240 14:72989459-72989481 GGGAGGTAGGGGAAGGAAAGGGG + Intronic
1119638791 14:76298237-76298259 GGGTGGAAGGGGAAGGCATTTGG - Intergenic
1119856269 14:77903568-77903590 ATGTGCCAGGGGATGGAAACAGG + Intronic
1119966463 14:78921615-78921637 GGGTGCTAGGTGGAGGAACCAGG + Intronic
1121403826 14:93705835-93705857 GGATGCTAGTGGAAGGAAAGCGG + Intronic
1121781354 14:96624395-96624417 GGGTGAGAGAGGAAGGAGACGGG - Intergenic
1121988098 14:98528074-98528096 GGGCCCAAGTGGAAGGAAATGGG + Intergenic
1121988288 14:98529385-98529407 GGGCCCAAGTGGAAGGAAATGGG + Intergenic
1125356612 15:38823032-38823054 TGATGAAAGGGGAAGCAAACAGG - Intergenic
1125793840 15:42389871-42389893 GGGTGGAAAGGGAAGGAGAGAGG - Intronic
1126275276 15:46871537-46871559 TGGTGGAAGAGGAAGCAAACAGG + Intergenic
1127624804 15:60769831-60769853 AAATGCAAGGGGTAGGAAACAGG - Intronic
1128107538 15:65055663-65055685 GGGTCCCTGGGGCAGGAAACAGG + Intronic
1128147491 15:65340106-65340128 GGCTGGAAGGGAAAAGAAACAGG + Intronic
1128520968 15:68374682-68374704 GGATGCTAGGGGAAGGAAGAAGG + Intronic
1128717227 15:69917506-69917528 GGATGCCGGGGGAAGGAAAATGG + Intergenic
1129411297 15:75352007-75352029 GGGTGCAAGGGGAAGGAAACTGG - Intronic
1129582806 15:76830880-76830902 GGGCTGAAGGGGAAGGAAGCTGG + Intronic
1130395678 15:83499065-83499087 TGGGGGAAGAGGAAGGAAACGGG - Intronic
1130817480 15:87453320-87453342 GGAAGCAAGGAGAAGGAAACTGG - Intergenic
1131583963 15:93673513-93673535 AGGAGGAAGGGGAAGGAAAAGGG - Intergenic
1133200370 16:4200510-4200532 GAGTGCAGGGGCAAGGAAGCGGG + Intronic
1133523280 16:6579597-6579619 TGGCGGAAGGGGAAGCAAACAGG - Intronic
1133589691 16:7230072-7230094 GGGAGGGAGGGGAAGGAAAGGGG + Intronic
1134207386 16:12249287-12249309 GGATGCAATGTGAAGGAAAATGG - Intronic
1134449407 16:14354239-14354261 GGGGGAAGGGGGAAGGAAAGGGG + Intergenic
1135077065 16:19402900-19402922 GGGTGGAAAGGGAAGAAAAGGGG + Intergenic
1135077616 16:19407642-19407664 GGGTGAAAAGGGAAGAAAAGGGG + Intergenic
1135392283 16:22103978-22104000 GGGGGGAAGGGGAAAGAGACTGG + Intronic
1135471601 16:22736356-22736378 TGGTTCAAGGGAAAGGGAACTGG + Intergenic
1136250138 16:28999006-28999028 GGGAGAAAGGGAAAGGAAAAGGG - Intergenic
1137067609 16:35864555-35864577 GGGTGCAGAGGGATGGAGACAGG - Intergenic
1138286664 16:55815587-55815609 GGATGCAAGGGGTAAGAAACGGG - Intronic
1138976590 16:62214817-62214839 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
1139077592 16:63471724-63471746 GTATGCAAAGGCAAGGAAACAGG + Intergenic
1139121500 16:64023850-64023872 GGGTGCGAGGCAAAGGAAAAAGG + Intergenic
1139365906 16:66433529-66433551 GGGCGCCAGGTGAGGGAAACAGG - Intronic
1139366114 16:66434467-66434489 GGGGGAAGGGAGAAGGAAACAGG + Intronic
1140105589 16:71956658-71956680 GGTTGGAAGGGGGAGGGAACAGG + Intronic
1140315023 16:73888289-73888311 GGGGGGAAGGGGAGGGAAAAAGG - Intergenic
1140946972 16:79777617-79777639 GTGTGCAGGGGGAGGGAAACAGG - Intergenic
1141038790 16:80654131-80654153 GGGTGCAAGGAGACGCAGACAGG + Intronic
1141070937 16:80954235-80954257 GGGCTGATGGGGAAGGAAACTGG + Intergenic
1141396525 16:83710069-83710091 GGGTGCGAGGGGAATGCCACTGG + Intronic
1143202439 17:5122147-5122169 GGGTGGCAGGGGAAGGAAGGTGG + Intronic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143645005 17:8224239-8224261 GGGCCCAAGGGGAGGGAGACAGG - Intergenic
1143738074 17:8927892-8927914 GGGTGCAGGGGGAAGGTGCCAGG - Intronic
1144123468 17:12179204-12179226 GGTCCCAAGGAGAAGGAAACAGG - Intergenic
1144202863 17:12956769-12956791 GGGGGCAAGAGGCAGGGAACAGG + Intronic
1144430350 17:15185542-15185564 GGGTGGAAGGAGAATGAGACTGG + Intergenic
1144877888 17:18411837-18411859 CGGTGTGAGGGGAAGAAAACGGG - Intergenic
1145154341 17:20532588-20532610 CGGTGTGAGGGGAAGAAAACGGG + Intergenic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146313351 17:31788141-31788163 GGGTCACAGGGGAATGAAACAGG + Intergenic
1146394307 17:32450683-32450705 GTATGAAAGTGGAAGGAAACAGG + Intronic
1146919314 17:36699495-36699517 GAGTGCAATGGAAAGGAAACAGG - Intergenic
1149335891 17:55635522-55635544 GGCTGCAAAGGAAAGGTAACTGG - Intergenic
1149480710 17:57001033-57001055 GGGTTCAACTGGAAGGGAACTGG + Intronic
1149633921 17:58150840-58150862 GTGTGCAAGGGGAAGGGTTCGGG - Intergenic
1150355990 17:64485158-64485180 TGGGGCAAGATGAAGGAAACCGG - Intronic
1150442610 17:65203436-65203458 GGGAGCCTGGGGAAGGAAACTGG - Intronic
1150611274 17:66735418-66735440 GGGGGCAGAGGGAAGGAACCAGG - Intronic
1151227267 17:72656506-72656528 GCGTGGAAAGGGAAGGAGACGGG + Intronic
1151974588 17:77477107-77477129 GGAGGGAGGGGGAAGGAAACAGG - Intronic
1152405409 17:80095455-80095477 GGGAGCAGCGGAAAGGAAACAGG + Intronic
1153610211 18:6877312-6877334 GGATGAAAGGGGCAGGAACCAGG + Intronic
1153997381 18:10454371-10454393 GGATGGAAGGGGTAGGAAGCTGG + Intergenic
1154371274 18:13765357-13765379 GGGCTCAAGGGGAAGGAAGCTGG + Intergenic
1154492645 18:14933445-14933467 GAGAGCAAGGGGCAGGAAATTGG + Intergenic
1154492659 18:14933492-14933514 GGGAGCAAGGGCCAGGAAATCGG + Intergenic
1155740148 18:29279324-29279346 AGGTTCAAGTGGAAGGAAAGAGG - Intergenic
1156454096 18:37283121-37283143 GGGTGGAAGAGGCAGGAGACTGG + Intronic
1156736551 18:40266585-40266607 TGAAGCAAGGGGAGGGAAACAGG + Intergenic
1157517140 18:48318881-48318903 GGTTGCCAGGGGAGGGGAACAGG - Intronic
1157564183 18:48668598-48668620 GGGTGCAAGGGGTAGGCAAGGGG - Intronic
1157592683 18:48845053-48845075 GGATGCTAGGGGAAAGACACTGG - Intronic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158528186 18:58234282-58234304 GGGAGGAAGGGGAAGGAGAAGGG - Intronic
1159352010 18:67287077-67287099 GGGATGAAGGGGAAGGAATCTGG - Intergenic
1160337013 18:78051181-78051203 GGGTGGTTGGGGAAGGAGACTGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162068496 19:8139925-8139947 AGGTGCAAGGGGAGGGGACCAGG - Intronic
1162083546 19:8234511-8234533 GGGTGCCAGGGGAAGGGAAATGG - Intronic
1163500348 19:17672523-17672545 GGGAGCAGGAGGGAGGAAACGGG + Intronic
1165371594 19:35410735-35410757 TGGTGGAAGGGAAAGCAAACAGG + Intergenic
1165388298 19:35524526-35524548 GGGTGCAAAGGGGAGGGAGCAGG + Intronic
1166782090 19:45348212-45348234 GGGTGCAAGTGGAAGGATCCTGG + Intronic
1166859441 19:45801325-45801347 GGGTGCAGAGGGAAGGGCACAGG + Intronic
1167296471 19:48653273-48653295 GATTGCAAGGGGAGGGAAACTGG - Intergenic
1167528119 19:49998053-49998075 TGGTGCAAAAAGAAGGAAACAGG + Intronic
1167696332 19:51017467-51017489 GCGTGAAAGTGGAAGGAAGCTGG + Intronic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
927199134 2:20567739-20567761 GGGTGAAAGGGCAAGGTCACAGG - Intronic
927604081 2:24470624-24470646 GGGTGCCAGAGGCAGAAAACAGG + Intergenic
927757039 2:25717100-25717122 GGGAGCATAGGGAAGCAAACAGG + Intergenic
928088129 2:28358378-28358400 TGGTGCAGGTGGAAGGAAAGGGG + Intergenic
929077166 2:38087572-38087594 TGAAGCAAGGGGAAGGAAAAGGG - Intronic
930257919 2:49113003-49113025 GTGTGGAAGGGAAAGAAAACGGG + Intronic
931645440 2:64417710-64417732 TGATGGAAGGGGAAGGAAAGTGG - Intergenic
932009046 2:67957095-67957117 GGGAGCAAGAGGAAAGAAATTGG + Intergenic
932214007 2:69954644-69954666 GGGAGGAAAGGGAAGAAAACAGG - Intergenic
933699318 2:85243455-85243477 GGGTTCGAGGGGAAGGGAAGGGG + Intronic
933902745 2:86861491-86861513 GGTCACCAGGGGAAGGAAACAGG - Intronic
934916293 2:98303286-98303308 GGGTGGAGGGGGAAGGATACTGG + Intronic
935226094 2:101054391-101054413 GGGTGCAAGGGACAGGAAGCAGG + Intronic
935428202 2:102943522-102943544 GGGTCCATGAGGAAGGACACAGG + Intergenic
935777802 2:106487777-106487799 GGTCACCAGGGGAAGGAAACAGG + Intergenic
935847612 2:107183858-107183880 GGAAGCAATGGGAAGGAATCCGG - Intergenic
938274560 2:130006375-130006397 GGGTGAAAGGGTAAGGGAACTGG - Intergenic
938440807 2:131330897-131330919 GGGTGAAAGGGTAAGGGAACTGG + Intronic
939054955 2:137353454-137353476 GGTTGCAAGGAAAAAGAAACAGG - Intronic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
940997988 2:160171186-160171208 GGGTGCAGGGGGAGAGAAAGAGG - Intronic
941229708 2:162896482-162896504 GGGTGGGAGGGGGAGGGAACTGG - Intergenic
941373427 2:164696733-164696755 GGAGGCATGTGGAAGGAAACAGG + Intronic
944513046 2:200483479-200483501 GGGTGAATGGGGCAGGTAACTGG + Intergenic
946001413 2:216485622-216485644 GGGAGCAGGGGGAAGGGAGCAGG - Intergenic
946231735 2:218295633-218295655 GGGTAGAAGGGGTAGGAAATAGG + Intronic
946410015 2:219511106-219511128 GGGTGCAGGGGGAGGGAGGCTGG + Intergenic
946612898 2:221478455-221478477 GGATGAAAGATGAAGGAAACTGG + Intronic
947349285 2:229225733-229225755 TGGTGGCAGGGGAAGCAAACAGG + Intronic
947708529 2:232295408-232295430 GGCTGCAAGAGGAAGGAAGATGG - Intronic
947994124 2:234512646-234512668 CGGTGCAAGGGGCTGGAACCAGG - Intergenic
948104980 2:235406256-235406278 GGGTGCAAAAGGGAAGAAACGGG + Intergenic
948186363 2:236024473-236024495 GGGTGCGAGGGGAGGGAAGGAGG - Intronic
948253802 2:236551611-236551633 GGGGGAAAGGGGAAGGAGTCTGG - Intergenic
948698369 2:239745514-239745536 GGATGGAGGGGGAAGGAGACAGG - Intergenic
948952014 2:241259310-241259332 GGGAGCAGGGTGAAGGTAACAGG + Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170122411 20:12925552-12925574 GACTGCAATGGGAAGGAAAGGGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170478701 20:16743772-16743794 GGGAGCAGGGGAAAGGAAAAAGG + Intergenic
1170868997 20:20187324-20187346 GGGTGCCAGGGGCAGGGAGCAGG + Intronic
1171370383 20:24658542-24658564 GGCTGCAAGATGAAGGACACAGG - Intronic
1172894923 20:38293732-38293754 GGGGGCAGGGGGCAGGGAACGGG + Intronic
1172912305 20:38419030-38419052 AGATGCCAGGGGAAGGAATCTGG - Intergenic
1173062997 20:39680050-39680072 TGGTGGAAGGGGAAGTAAACAGG + Intergenic
1173617810 20:44414280-44414302 GGGGGCAGGGGGCAGGTAACAGG + Intronic
1174114582 20:48218228-48218250 GGGGGCAAGGGGAAGGAGCTGGG - Intergenic
1174204866 20:48830929-48830951 GGCTGCAAGGAGAAGAAAACTGG + Intergenic
1174544123 20:51312539-51312561 GTTTGCAAGGGAAAGGAACCTGG - Intergenic
1175218486 20:57403999-57404021 GTCTGCAAGGGTCAGGAAACAGG + Intronic
1175221620 20:57420663-57420685 GGGTGCTGGGGGCGGGAAACTGG + Intergenic
1175318868 20:58071479-58071501 GGGAGCAAGAGGGAGGAAAAGGG - Intergenic
1176062014 20:63176596-63176618 GGGTGGAAAAGGAAGGAAGCAGG + Intergenic
1176214544 20:63941923-63941945 GTGTGGCAGGGGAAGGAAAGAGG + Intronic
1176672227 21:9745253-9745275 AGGGGCAAGAGGAAGGAGACAGG + Intergenic
1177240876 21:18455142-18455164 TGGTGGAAGGGGAAGCAAACAGG - Intronic
1178119658 21:29456148-29456170 GCATGAAAGGGGAAGGAAAAAGG - Intronic
1178429671 21:32508350-32508372 GGGCGCAGGGGTAAGGAAGCTGG + Intronic
1178540279 21:33443762-33443784 GGATTCAAGGGTAAGTAAACAGG + Intronic
1178891585 21:36524915-36524937 GGGTGGAAGGGGAAAGTACCTGG - Intronic
1180459950 22:15553640-15553662 GGATGAAAGGGCAAGGGAACTGG + Intergenic
1180741838 22:18058927-18058949 GGGTGGAGAGAGAAGGAAACAGG + Intergenic
1180746218 22:18090787-18090809 GGGTGGAATGGAGAGGAAACAGG + Exonic
1181129880 22:20724867-20724889 GGAGCCAGGGGGAAGGAAACAGG + Intronic
1181581201 22:23829061-23829083 GGGCTCAAGGGGAAGGAGGCTGG + Intronic
1182256383 22:29041858-29041880 GGGTGACATGGGAAGGAAAAAGG + Intronic
1182547115 22:31082792-31082814 GGGTGGGTGGGGCAGGAAACTGG + Intronic
1182572589 22:31249832-31249854 GGGGGAAGGGGGAAGGGAACTGG + Intronic
1183187605 22:36300832-36300854 GGGTGCAGCGGGCAGGAACCTGG + Exonic
1183413257 22:37667713-37667735 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
1183528237 22:38336653-38336675 GGCTGCGAGGAGAAGGAAACAGG - Intronic
1185144415 22:49123153-49123175 GGGGGCAAATGGAAGGAAAGTGG + Intergenic
949832304 3:8228438-8228460 GGGGGCAACAGGAAGGAAAAGGG - Intergenic
949841845 3:8328491-8328513 GAGTGCATGGGGAAGAAAATGGG - Intergenic
949945220 3:9184776-9184798 GGGTGCAAGGATAAGGAGCCAGG - Intronic
950531021 3:13552461-13552483 GGGGACCTGGGGAAGGAAACTGG - Intronic
950769511 3:15300510-15300532 GGGGACAAGAGGAAGAAAACAGG + Intronic
950996004 3:17496939-17496961 GGGTGACAGGGGAATGACACAGG - Intronic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
952531096 3:34262754-34262776 GGGTGTAAAAGGAAGGAACCAGG + Intergenic
952726827 3:36595314-36595336 GGGTGAAAGGAGAAGGAGAAAGG - Intergenic
953287916 3:41630743-41630765 GGAGGCAGGGGGAAGGGAACTGG - Intronic
954432938 3:50480890-50480912 GGGAGGAAGGGGGAGGAAAGGGG + Intronic
954692642 3:52403874-52403896 AGGTATAAGGGGAAGGGAACAGG - Exonic
954702338 3:52456696-52456718 GAAGGCAAGGGGAAGGAATCAGG + Intronic
954711315 3:52506369-52506391 GGGCTCATGGGGAAGGAAGCAGG + Intronic
954908541 3:54083899-54083921 TGGTGCTTGGGAAAGGAAACGGG + Intergenic
955379304 3:58423916-58423938 GTGGGCAAGGAGAGGGAAACTGG - Intronic
956711727 3:72044192-72044214 GGGGGCAAGGAGAAGGCTACTGG - Intergenic
956884031 3:73540661-73540683 TGGTGAAAGGGGAGGTAAACAGG - Intronic
957485072 3:80850301-80850323 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
957878732 3:86183285-86183307 GGGCTGAAGGAGAAGGAAACTGG + Intergenic
959021868 3:101196138-101196160 GGGTGAAAGGGTAGGGATACAGG + Intergenic
959402142 3:105915625-105915647 TGGTAGAAGGGGAAGCAAACAGG - Intergenic
959622402 3:108412364-108412386 TGGTGGAAGGGGAAGCAAATAGG - Intronic
960502688 3:118456041-118456063 GTGTGCATGGGGCAGGAAACTGG - Intergenic
961307616 3:125969530-125969552 GAGGGCAAGGGGAAGGCAAGGGG + Intronic
961785451 3:129344313-129344335 GGGTGCAAGGGTAAGGTGCCAGG - Intergenic
962054006 3:131849391-131849413 TGATGGAAGGGGAGGGAAACAGG + Intronic
962263416 3:133928882-133928904 GTGTGCAAAGGTAAGGAAGCAGG - Exonic
962972692 3:140418924-140418946 GGGTGGAAGGAGCAGGAAATGGG - Intronic
963345787 3:144095481-144095503 GGGTGAAAGGGGAAGAAAGGGGG - Intergenic
964339726 3:155695897-155695919 GGGTGCAAAGAGAAGGGAAAGGG + Intronic
964833351 3:160910293-160910315 GAGGGGAAGGGGAAGGGAACGGG - Intronic
965916449 3:173853059-173853081 GTGTGCAAAGTGAAGGAGACGGG - Intronic
966077428 3:175954728-175954750 AGGTGCAAGGAGAAGGAGAAAGG + Intergenic
967253246 3:187564450-187564472 GAGTCCATGGGGAAGGATACAGG + Intergenic
967327323 3:188254426-188254448 TGGTGGAATGGGGAGGAAACTGG + Intronic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969291322 4:6241786-6241808 GTGTGCAAAGGGAAGGAGATTGG + Intergenic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
972265687 4:37456792-37456814 GGCTGCAATGAGAATGAAACAGG + Intronic
973001747 4:44960903-44960925 TGGGGAAAGGGGAAGGAAAAGGG - Intergenic
973537328 4:51896530-51896552 GGGTCAAAGAGGAGGGAAACTGG - Intronic
973864675 4:55100108-55100130 GAGTGCAAGGAGAATCAAACCGG + Intronic
975227200 4:71887909-71887931 TGGTGGAAGGGAAAGCAAACAGG + Intergenic
976829591 4:89299391-89299413 GTGTGCATGAGGAAGGAAAGTGG + Intronic
977696364 4:99971110-99971132 GAGCTGAAGGGGAAGGAAACTGG + Intergenic
978339781 4:107710055-107710077 GGGTGCAGAAGGAAGGAAAGGGG - Intronic
978414376 4:108459850-108459872 GGGTGCAGGAAAAAGGAAACTGG - Intergenic
979688302 4:123535552-123535574 GGGTGGGAGGGAAAGGAAATGGG + Intergenic
980021414 4:127714486-127714508 GGATGGAAGAGGAAGGAGACAGG - Intronic
980245763 4:130239190-130239212 GGCAGCAAGGGGATGGAAATAGG + Intergenic
980286735 4:130788972-130788994 GGGAGGAAAGGGAAGGAAAGAGG + Intergenic
981315677 4:143337372-143337394 GGGGCCAAGGGGAAAGAGACCGG - Intronic
981579310 4:146236266-146236288 GGATGCTGGGAGAAGGAAACAGG - Intergenic
982131216 4:152230420-152230442 TGCTGCAGGGGGAAGGAGACAGG - Intergenic
982329257 4:154163178-154163200 GGGTGAAAGGGGAAAGTCACAGG + Intergenic
983640461 4:169940315-169940337 TGGCAGAAGGGGAAGGAAACGGG - Intergenic
984139996 4:175993131-175993153 GGGAGAGAGGGGAGGGAAACAGG - Intronic
984214127 4:176887282-176887304 GGGAGGAAGGGGAAAGAAAGAGG - Intergenic
985234188 4:187854944-187854966 GGGTGTAAGGGGAGGGGAAATGG + Intergenic
985495902 5:205627-205649 GCCTGCAAAGGGAAGAAAACTGG - Exonic
985683043 5:1266379-1266401 CGGTGCCAGGGGCAGGACACGGG + Intronic
985763239 5:1762656-1762678 TGGTGAACGGGTAAGGAAACCGG - Intergenic
985788515 5:1912580-1912602 GGGAGCCAGGGGCAGGGAACAGG + Intergenic
986221772 5:5774952-5774974 GGGAGGAAGGGGAAGGGAAGGGG - Intergenic
987188874 5:15452762-15452784 GGGTGAAGGGAGAATGAAACAGG + Intergenic
987471023 5:18327682-18327704 GGCAGCAATGGGAAGGAAAAAGG + Intergenic
990304345 5:54480171-54480193 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
991442635 5:66667024-66667046 AGATGCAAAGGGAAGGAAAGAGG + Intronic
991585753 5:68200312-68200334 GGGGCCAAAAGGAAGGAAACAGG - Intergenic
992268734 5:75044278-75044300 GGCAGCAAGGGGAGGGAAAAGGG - Intergenic
994264589 5:97700012-97700034 GGGAGCAAGGGCCAGGAAAGGGG - Intergenic
994297282 5:98105757-98105779 GGGTGCAAGGGGGAAGGAAACGG + Intergenic
994406810 5:99355142-99355164 GGGTGAAAGGAGAAGGGAAAAGG - Intergenic
995181935 5:109237681-109237703 TGGTGGAAGTGGAAGCAAACAGG - Intergenic
995609085 5:113889823-113889845 GGGGGCAACGAAAAGGAAACTGG - Intergenic
996492494 5:124114629-124114651 GGGAGCAAGAGTGAGGAAACAGG + Intergenic
997385086 5:133466040-133466062 GGTTGTGAGTGGAAGGAAACGGG + Intronic
998128634 5:139640100-139640122 GGGTGCCACGGGAAGGGAAAAGG - Intergenic
998254700 5:140575611-140575633 TGGTGGATGGGGAAAGAAACTGG + Intronic
1000054439 5:157592556-157592578 AGGTGCTGGGGGAAGAAAACTGG - Intergenic
1000286567 5:159831966-159831988 GGGTGCTAGGAGCAGGAAATGGG - Intergenic
1001974595 5:175987146-175987168 GGGTGCCAGGTGAATGAATCAGG - Intronic
1002242839 5:177856633-177856655 GGGTGCCAGGTGAATGAATCAGG + Intergenic
1002493927 5:179599233-179599255 GGGAGCCAGGGGAAGGAACGTGG + Intronic
1003420432 6:5952902-5952924 GGGTCGTAGGGGAAGGAAACTGG - Intergenic
1005055204 6:21722658-21722680 GTTTGCAGGGGGAAGGAGACAGG - Intergenic
1005587046 6:27287003-27287025 GGGGGCAGGGGGAAGAAAAAGGG + Intronic
1006586291 6:35116357-35116379 GGTTGCCAGGGGAAGGGAATGGG + Intergenic
1006809217 6:36809168-36809190 GGCTGCAAGGGGAGGGATAGAGG - Intronic
1008010291 6:46459760-46459782 GGGAGGCAGGGGAATGAAACAGG + Intronic
1008373730 6:50767467-50767489 GGGGACAATGGGAAGAAAACAGG - Intronic
1009576573 6:65470279-65470301 GGGTGCAATGGGAAGTAAAGTGG + Intronic
1010756409 6:79670618-79670640 GGGTGCAAGCTGTAGAAAACTGG + Intronic
1012796970 6:103774567-103774589 GGGTCCAATAGGAAGGAAATAGG - Intergenic
1012838774 6:104303173-104303195 GGGTGGAAGGGAAAGGTAAGGGG - Intergenic
1013115311 6:107099097-107099119 GGGTGGAGGGGGATGGGAACCGG + Intronic
1013298742 6:108782950-108782972 GGGGGCAAGGGAAATGAAAGTGG + Intergenic
1013365412 6:109433944-109433966 GGCTGAAAGGGGAGGGAAACTGG + Intronic
1013487796 6:110614662-110614684 GAGTGCTAGGAGAAGGAAACAGG + Exonic
1014459060 6:121673565-121673587 GGGAGCAAGGGGAAGGAAGGCGG - Intergenic
1014882927 6:126745615-126745637 TGGTAGAAGGGGAAGAAAACAGG + Intergenic
1014899110 6:126941626-126941648 GGGTGCAGTGGGAATGAACCAGG - Intergenic
1015939111 6:138431310-138431332 GGGGGCAATGGCAAGGACACAGG + Exonic
1017290960 6:152736023-152736045 GGGGCCAAGGGGAAGCAAAGTGG + Intergenic
1017862100 6:158408331-158408353 GGGTGCAAGTGGTGGGAGACAGG + Intronic
1018756129 6:166851151-166851173 GGGTGCAAGGCGTGGAAAACAGG + Intronic
1019647358 7:2138237-2138259 GGGTCCAAAGGGAAGGAGAAAGG + Intronic
1019762444 7:2823413-2823435 GAGTGCTTGGGGAAGGTAACAGG + Intronic
1019763934 7:2835499-2835521 GGGTCCAAGGGGAGGGAATGTGG + Intronic
1020753685 7:12173610-12173632 AGGAGCAAGGGGAGGAAAACAGG + Intergenic
1020791899 7:12637485-12637507 GGGAGAAAGGGGAAAGAAAAGGG + Intronic
1021105062 7:16628685-16628707 GGGTGGTAGGGGAAGGACACAGG + Intronic
1021425502 7:20495498-20495520 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1021634950 7:22682816-22682838 GGGTGCAAGGGGAGGCAAGAAGG + Intergenic
1022119832 7:27297433-27297455 GGGTCCATGGGGATGGAAGCTGG + Intergenic
1024122715 7:46261056-46261078 GGGTGCTGGGAGATGGAAACAGG + Intergenic
1027505734 7:79015926-79015948 GGGTCAAAGGGGCAGGAAGCAGG + Intronic
1027854002 7:83485753-83485775 GGGTGCATGTGGAGGGAAATAGG + Intronic
1028177572 7:87675184-87675206 GGGTGGAAGAGGGAGGAAGCCGG - Intronic
1028333746 7:89626171-89626193 GGGTAAAAGGGGAAGGAGAGGGG + Intergenic
1029150529 7:98477321-98477343 GGGTGCAAAGGGAGGGACAGAGG - Intergenic
1030093911 7:105880969-105880991 GCCTGCAAGGGGCAGGAAAGAGG - Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1030785469 7:113655345-113655367 GGTTTCAAGGTGAAGGAAAAAGG + Intergenic
1032284680 7:130531346-130531368 GGGTGCAAGGTCAAGGTAAGGGG + Intronic
1032999860 7:137492423-137492445 GGGTTTAAGGGGGAGGAAGCTGG + Intronic
1033092207 7:138396309-138396331 AAGTGCAAAGGGAAGGAAAATGG - Intergenic
1033160736 7:138994125-138994147 GGGTGAAGGGGGAGGGACACGGG - Intergenic
1033306500 7:140229918-140229940 GGGTGAAATGGGAAGGCAGCAGG - Intergenic
1033869094 7:145728132-145728154 GGGTTCAAGGAGAAGGAAGGGGG + Intergenic
1034051997 7:147993873-147993895 TTGTGAAGGGGGAAGGAAACAGG - Intronic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1034610499 7:152363565-152363587 GGGAACAAAGGGAAAGAAACAGG + Intronic
1035795230 8:2350034-2350056 TGGTGAAAGGGGAAGCAAACAGG - Intergenic
1035996114 8:4549295-4549317 GAATGCGAGGGGAAGGAAAAGGG + Intronic
1036768820 8:11565266-11565288 GGGTTCAAGGGGAAGGAAGCGGG - Intergenic
1037133699 8:15437698-15437720 GGGTGCAGCTGGAAGGATACAGG - Intronic
1037182215 8:16021250-16021272 GGATGCAAGGCTATGGAAACTGG + Intergenic
1037260400 8:17001675-17001697 AGGTGCAAGGGGAGGGAACGAGG + Intronic
1037631907 8:20665649-20665671 GAATGCAAAGGGAAGGAAAGGGG - Intergenic
1037882436 8:22579606-22579628 GGGCCCAAGGGGAAGGCAGCCGG + Intronic
1038716834 8:29998762-29998784 GAGTGGATGGGGAAGAAAACAGG + Intergenic
1038883562 8:31639897-31639919 TGCTGCGAGGGGAAGGAAAAGGG + Intronic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1039442534 8:37605071-37605093 GGGGGCAAAGGGAAGGAGATGGG + Intergenic
1039615103 8:38949298-38949320 GTGGGCAAGGAGGAGGAAACAGG + Intronic
1040576217 8:48653852-48653874 GGGTGCAAGGGAAATGTGACTGG - Intergenic
1040668404 8:49658223-49658245 GGGCTGAAGGGGGAGGAAACTGG + Intergenic
1041368307 8:57132347-57132369 GGAAGGGAGGGGAAGGAAACAGG + Intergenic
1041413942 8:57587017-57587039 GGGTGGAAGGGGAAGTAGAAAGG + Intergenic
1041442812 8:57915958-57915980 GGCTGCAAGGAGAAGCAAATGGG + Intergenic
1041663355 8:60420204-60420226 GGGTGCAATGAGAGTGAAACAGG + Intergenic
1042085883 8:65108312-65108334 GGATGCAAGGAAAAGGAAAAGGG + Intergenic
1042088151 8:65131317-65131339 GGGTAAAAGGGGAAGGAGATGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044473301 8:92597398-92597420 GGGTGCAAACGGTAGGATACTGG - Intergenic
1044600610 8:94000199-94000221 GGGTGCAAAGGGAAGAAGAAGGG + Intergenic
1045284880 8:100781893-100781915 GGGTGCATGGGGAAGGGAGAGGG - Intergenic
1048061731 8:130925902-130925924 GAGGCCAAAGGGAAGGAAACTGG - Intronic
1050641879 9:7677119-7677141 GGCTGCAATGGGAAAGAAGCTGG + Intergenic
1051419576 9:16876339-16876361 GGGTGGAAGGGGACCCAAACCGG + Intergenic
1051512679 9:17896520-17896542 TTGTGGAAGGGGACGGAAACAGG + Intergenic
1051942298 9:22522499-22522521 GGCAGCAAAGGGAAAGAAACAGG - Intergenic
1052548346 9:29910583-29910605 GAGTGCAAGGGGAAGAATACAGG + Intergenic
1053107537 9:35424630-35424652 AGCTGCAAGGGGAAGGATAAAGG - Intergenic
1053143880 9:35699003-35699025 GGGTGGAAGAGGAAGGGAGCAGG + Intronic
1053382637 9:37661253-37661275 GGGTGCAGGGGGAAGTACCCAGG + Intronic
1054703557 9:68438713-68438735 GGGTTCAAGTGGAAGAATACTGG - Intronic
1054862659 9:69969499-69969521 GAGTGCCAGGGGAGGGAAACAGG + Intergenic
1055140896 9:72876008-72876030 CAGTGCAAGGGAGAGGAAACAGG + Intergenic
1055661275 9:78506450-78506472 GCTTGAAAGGGGAAGAAAACAGG + Intergenic
1056821617 9:89846054-89846076 GCGTGTAAGGGGAGAGAAACGGG + Intergenic
1057068635 9:92077114-92077136 GAGTGCAAGGGGTAGGAGAGTGG - Intronic
1057108604 9:92445313-92445335 AGGCTCAAGGGGAAGGAAGCTGG - Intronic
1057309223 9:93931340-93931362 GGGGGCAAGGGCATGGACACAGG + Intergenic
1057699931 9:97356362-97356384 GGGTGAAATGGGCAGGAAGCTGG - Intronic
1057798517 9:98175169-98175191 GAGTGAAAGGGGAAGCAGACAGG - Intronic
1057801746 9:98195313-98195335 GGGTGCACTGGGAAGGAAGAGGG - Intergenic
1060190340 9:121588570-121588592 GGGTGAAGGGGGAAGGGAAGGGG + Intronic
1061043155 9:128151143-128151165 GGGTGCCAGGGGATGGGAAGTGG + Intronic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061950095 9:133931333-133931355 GGGAGCAAGGGGCAGGGACCAGG + Intronic
1185511528 X:668012-668034 GGGGGGAAGGGGAAGGAGAGGGG - Intergenic
1186149339 X:6657652-6657674 GGATGGAAGGGGAAGGGAGCTGG - Intergenic
1187865221 X:23717578-23717600 GGCTGCATGGGAAAGGAAGCAGG + Intronic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1189034327 X:37480044-37480066 GGGTAAAAGGGGAAGGAGAGGGG + Intronic
1190635000 X:52424790-52424812 GGGTGGGAGGGGAACGCAACAGG - Intergenic
1190734466 X:53246897-53246919 GGGGGTAAGGGGAAGGATGCAGG - Intronic
1191655067 X:63586960-63586982 GGGCTGAAGGGGAAGAAAACTGG - Intergenic
1191685421 X:63884857-63884879 GGCTGCAAGGGAACAGAAACAGG + Intergenic
1191778349 X:64842965-64842987 GGGTGAAAGGGGGAGGGAAAAGG - Intergenic
1192357520 X:70418116-70418138 GGGTGCAGAGGGAAGGAGAAGGG - Intronic
1192831653 X:74756529-74756551 AGGAGCAAGGGAAAGGATACAGG + Intronic
1192919327 X:75689925-75689947 GGATGCAAGGGGAAGAAGCCTGG + Intergenic
1194261430 X:91700241-91700263 GGGTTGAAGGGGGAGGAAGCTGG - Intergenic
1194268077 X:91779294-91779316 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1196148227 X:112343299-112343321 GAGTGGAAGGGAAAAGAAACAGG - Intergenic
1198511077 X:137352419-137352441 GGATTGAAGGGGAAGGAAGCAGG - Intergenic
1199570465 X:149262307-149262329 GGGAGGAGGGGGAAAGAAACAGG - Intergenic
1200068654 X:153517412-153517434 GGGTGGGTGGGGATGGAAACTGG - Intergenic
1200585280 Y:5000215-5000237 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1201764434 Y:17565108-17565130 AGGCCCACGGGGAAGGAAACAGG - Intergenic
1201837119 Y:18340882-18340904 AGGCCCACGGGGAAGGAAACAGG + Intergenic