ID: 1129412074

View in Genome Browser
Species Human (GRCh38)
Location 15:75355702-75355724
Sequence ATGGCTTCCCAGGTATTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 4, 3: 78, 4: 278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129412074_1129412088 19 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412088 15:75355744-75355766 CCCCACCCCAAGCGTGAGGATGG 0: 1
1: 0
2: 3
3: 12
4: 175
1129412074_1129412097 30 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412097 15:75355755-75355777 GCGTGAGGATGGGCCCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 81
1129412074_1129412096 29 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412096 15:75355754-75355776 AGCGTGAGGATGGGCCCTAAGGG 0: 1
1: 0
2: 0
3: 0
4: 60
1129412074_1129412085 15 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412085 15:75355740-75355762 CCACCCCCACCCCAAGCGTGAGG 0: 1
1: 0
2: 13
3: 40
4: 392
1129412074_1129412090 20 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412090 15:75355745-75355767 CCCACCCCAAGCGTGAGGATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1129412074_1129412095 28 Left 1129412074 15:75355702-75355724 CCACCAAATACCTGGGAAGCCAT 0: 1
1: 1
2: 4
3: 78
4: 278
Right 1129412095 15:75355753-75355775 AAGCGTGAGGATGGGCCCTAAGG 0: 1
1: 0
2: 3
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129412074 Original CRISPR ATGGCTTCCCAGGTATTTGG TGG (reversed) Exonic
900294602 1:1942656-1942678 ATGGCCTCCCAGGTGACTGGCGG - Intronic
900717724 1:4156074-4156096 ATAGCTTCTCAGGCATTTGCTGG + Intergenic
902369389 1:15996144-15996166 ATGGCTGCCCAGATATCTGCTGG + Intergenic
903073132 1:20738244-20738266 ATGGCTGCCTAGGCATCTGGTGG + Intergenic
906097585 1:43234729-43234751 AGGGCTCCCCAGGTGTCTGGGGG + Intronic
906438300 1:45816253-45816275 AAGACTTTCCAGGTATTTGAAGG - Intronic
906735009 1:48116791-48116813 AAGGCTTTCCAGGTATTTAAAGG - Intergenic
906915593 1:50005498-50005520 AAGGTTTTCCAGGTATTTGAAGG - Intronic
908460328 1:64342646-64342668 ATGGGTTCCCTGGAATTTGCAGG - Intergenic
909029298 1:70520854-70520876 ATTTCTTCCTAGGAATTTGGAGG + Intergenic
909559051 1:76989438-76989460 ATGTCTTGCCATGAATTTGGAGG - Intronic
911020004 1:93376281-93376303 AAGGCTTTCTAGGTATTTGAAGG - Intergenic
912316562 1:108671842-108671864 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
912633128 1:111266662-111266684 AGGGCTTTCCAGGTATTTGAGGG + Intergenic
912872976 1:113327206-113327228 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
912899125 1:113629569-113629591 AAGGCTTTCCAGGTATTCGAAGG + Intronic
912906723 1:113715139-113715161 AAGGCTTTCCAAGTATTTGAGGG - Intronic
913086548 1:115442610-115442632 AAGCCTCCCCAGTTATTTGGGGG - Intergenic
913144387 1:115975875-115975897 ATGGCTGCCAAGGTATTTAAAGG - Intergenic
913364473 1:118021377-118021399 AGTGGTTCCCAGGTGTTTGGTGG + Intronic
913718756 1:121568547-121568569 ATGTATTCCCATGTATTTGGGGG + Intergenic
914861444 1:151389524-151389546 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
915221756 1:154380168-154380190 ATCACTTCCCAGATAGTTGGCGG + Intergenic
917246208 1:173004219-173004241 AAGGCTTTCTAGGTATTTGAAGG + Intergenic
918915624 1:190633614-190633636 AAGGCTTTGCAGGTATTTGAAGG + Intergenic
919169926 1:193940253-193940275 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
919458444 1:197847311-197847333 CTGTGTTCCCAGGTACTTGGGGG + Intergenic
920772482 1:208902460-208902482 ATGTAGTCCCAGGTACTTGGGGG - Intergenic
920953510 1:210596966-210596988 AAGGCTTTCCAGGTATTTGAAGG + Intronic
921012000 1:211150909-211150931 AGGGCTCTCCAGGTATTTGAAGG - Intergenic
921663745 1:217840734-217840756 CTGGAGTCCCAGCTATTTGGAGG + Intronic
922019549 1:221689590-221689612 CTGTTTTTCCAGGTATTTGGAGG + Intergenic
922223424 1:223626136-223626158 ATGACTTCCCAGTTTCTTGGTGG - Intronic
922320348 1:224481391-224481413 AAGGCTTTCCAGGTATTTGAAGG + Intronic
923525644 1:234770463-234770485 CTGGCTTCCCAGACGTTTGGAGG + Intergenic
924283865 1:242465456-242465478 ATGGCTTCCCATTTATTTCAGGG + Intronic
1062777305 10:163229-163251 GTTGCTTCCCAGGTAGTGGGGGG - Intronic
1064446661 10:15399584-15399606 AAGGCTTTCCAGATATTTGAAGG - Intergenic
1065431327 10:25660446-25660468 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1067562733 10:47315200-47315222 GAGGCATTCCAGGTATTTGGGGG - Intergenic
1067944086 10:50679561-50679583 ATGGCTGCCCAGGTGGTTGGGGG + Intergenic
1068237394 10:54256061-54256083 ATACCCTCCCAGCTATTTGGTGG + Intronic
1068834737 10:61541641-61541663 ATTGCTTTCAAGGTTTTTGGTGG + Intergenic
1069343626 10:67440794-67440816 AAGGCTTCCCAGGTATTTGAAGG - Intronic
1069391874 10:67944449-67944471 AAGGCCTTCCAGGTATTTAGAGG - Intronic
1070464370 10:76704549-76704571 AAGGCTTTCCAGGTATTTGTAGG - Intergenic
1070865580 10:79706431-79706453 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1070879373 10:79844562-79844584 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1070964557 10:80521617-80521639 ATGGCTCCCCAGATTTCTGGAGG - Exonic
1071632481 10:87228652-87228674 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1071645930 10:87360870-87360892 ATGGCTGCCCAGGTGGTTGGGGG + Exonic
1073757411 10:106595437-106595459 ATGGCTTCCCAGACCTTTGATGG + Intronic
1074302011 10:112241602-112241624 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1074957442 10:118406158-118406180 TTGGCTTCCCAGGTCTGTGAAGG + Intergenic
1075874531 10:125795420-125795442 ATGTCTTGCCTGGTATTGGGAGG - Intronic
1078842934 11:15096057-15096079 AAGGCTTTCCAAGTATTTGAAGG + Intergenic
1079473748 11:20807188-20807210 AAGGCTTTCCAGGTATTTGAAGG + Intronic
1079532992 11:21477550-21477572 AAGGCTTTCCAGGTATTTGAAGG - Intronic
1079760063 11:24318553-24318575 ATGGCTTTCCAGGTATTTGAAGG + Intergenic
1080489640 11:32749665-32749687 AAGGCTTTCCAGGTATTTGAAGG + Intronic
1081327630 11:41764825-41764847 AGGGCTGCCCAAGTTTTTGGAGG - Intergenic
1081660907 11:44887863-44887885 ATGGCTTCACGGGTATTAAGGGG - Intronic
1084581813 11:70028902-70028924 CTGTCTTCCCAGCTACTTGGAGG - Intergenic
1084993371 11:72950756-72950778 TTGGCTTCTCAGATATTTAGAGG + Intronic
1085223585 11:74896886-74896908 AAGGCTTTCCAGGTATTTGAAGG - Intronic
1085562924 11:77488290-77488312 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1085980648 11:81719541-81719563 AAGGCTTTCCAGGAATTTGAAGG - Intergenic
1086033236 11:82384845-82384867 AAGACTTTCCAGGTATTTGAAGG - Intergenic
1086623584 11:88917338-88917360 AGGGCTTTCCAGGTATTTAAAGG - Intronic
1087070866 11:94079014-94079036 ATTGCTTGACAGGTATTTGGAGG - Intronic
1088849650 11:113694601-113694623 CTGGCTTCCCGGATAGTTGGTGG - Exonic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1090065113 11:123497103-123497125 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1090084670 11:123640720-123640742 ATGACTCCCCAGGTGATTGGAGG - Intronic
1092759668 12:11798290-11798312 ATGGCTGCCCACCAATTTGGAGG - Intronic
1092900609 12:13056119-13056141 AATGATTCCCAGGTTTTTGGAGG - Intronic
1093315085 12:17639446-17639468 TGGGCTTTTCAGGTATTTGGGGG - Intergenic
1093538339 12:20248897-20248919 AAGGCTTTCCAAGTATTTGAAGG - Intergenic
1094142121 12:27192151-27192173 AGGGCTTCCTAGGTCTTTGCTGG - Intergenic
1094411191 12:30170159-30170181 GTGGGTTCCCAGTTTTTTGGGGG - Intergenic
1094655749 12:32418397-32418419 AAGGCTTTTCAGGTATTTGAGGG + Intronic
1095694824 12:45132586-45132608 ATGGCTTCCCAGTTTTGTGCTGG - Intergenic
1097425911 12:59445045-59445067 AAGGTTTTCCAGGTATTTGAAGG + Intergenic
1098333642 12:69380236-69380258 CAGGCTTTCCAGGTATTTGAAGG + Intronic
1098996468 12:77126432-77126454 GTGGCTTCCCAGGGCTTAGGGGG + Intergenic
1099882374 12:88481552-88481574 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1099943551 12:89218777-89218799 ATGTCATCCCAGGTATTTTAGGG - Intergenic
1100717592 12:97322168-97322190 ATGGCTTTCCAGGTGCGTGGGGG + Intergenic
1102595848 12:113992128-113992150 CTGGCTTCCCTGGCATTTGGGGG - Intergenic
1103739641 12:123082557-123082579 CTGTATTCCCAGCTATTTGGAGG - Intronic
1103827376 12:123750528-123750550 ATGGCTTCCCAGGGTTTGGACGG - Intronic
1104204204 12:126620861-126620883 TTGTCTTCTCAGTTATTTGGAGG + Intergenic
1104337433 12:127912670-127912692 TTGGCTGCCCAGGTTTTGGGGGG + Intergenic
1107178247 13:37424106-37424128 AAGACTTTCCAGGTATTTGAAGG - Intergenic
1109463622 13:62697248-62697270 ATGGCTTCCAAGGTACTTCTGGG + Intergenic
1110376859 13:74803537-74803559 AAGGCTTCCCAGGTATTCAAGGG - Intergenic
1110448630 13:75617044-75617066 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1110916658 13:81030024-81030046 AAGGCTTCCCAGGTATTTGAAGG + Intergenic
1114358222 14:21938826-21938848 CTGTATTCCTAGGTATTTGGGGG + Intergenic
1115127275 14:30010999-30011021 AGAGCTTCCCAGTTATTTTGTGG - Intronic
1116669312 14:47821047-47821069 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1116766095 14:49071523-49071545 AAGGCTTTCCAAGTATTTGAAGG - Intergenic
1117606857 14:57439324-57439346 AAGGCTTTCCAAGTATTTGTAGG + Intergenic
1118034081 14:61848202-61848224 AAAGCTTTCCAGGTATTTGAAGG + Intergenic
1118255040 14:64198518-64198540 TTAGATTCCCAGGCATTTGGAGG + Intronic
1118431066 14:65719592-65719614 AAGGCTTTCCAGATATTTGAAGG + Intronic
1118543674 14:66859469-66859491 AAGGCTTTCCAGGTATTTGAAGG - Intronic
1119737877 14:76995527-76995549 GGGGCTTCCCAGGCAGTTGGGGG - Intergenic
1120439533 14:84519560-84519582 AAGGTTTTCCAGGTATTTGAAGG + Intergenic
1120697579 14:87660622-87660644 AAGGCTTTCTAGGTATTTGAAGG - Intergenic
1121230293 14:92352633-92352655 CTGGCTTCCGATGTATTTCGGGG - Intronic
1121313239 14:92946320-92946342 ATGCCTTCCCAGGTGAGTGGCGG - Exonic
1122087498 14:99317873-99317895 ATGGCTGCCCAGTGATGTGGAGG - Intergenic
1124479595 15:30066741-30066763 TTGGATTCCTAGGTATTTTGTGG - Intergenic
1124574786 15:30897449-30897471 ATTGTTTGCCAGGGATTTGGAGG - Intergenic
1124863295 15:33463956-33463978 ATGAATTCCCAGGTTTTTTGGGG + Intronic
1126321551 15:47429610-47429632 ATTCCTTCCCAGGCAGTTGGTGG - Intronic
1129412074 15:75355702-75355724 ATGGCTTCCCAGGTATTTGGTGG - Exonic
1130511943 15:84596470-84596492 AAGGCTCTCCAGGTATTTGAAGG - Intergenic
1130961848 15:88664670-88664692 AAGGCTTCCCAGGCATTTGAAGG - Intergenic
1132713499 16:1279424-1279446 CTGGCTGCCCTGGAATTTGGCGG - Intergenic
1136126038 16:28181479-28181501 ATGGATTCTCAGGGGTTTGGGGG + Intronic
1138806737 16:60099452-60099474 AAGACTTTCCAGGTATTTGAAGG + Intergenic
1141700986 16:85641924-85641946 CTGGGTTCCCAGGTTTTGGGTGG + Intronic
1141981028 16:87550662-87550684 ATGGATTCCCTGGTATTCAGGGG - Intergenic
1143458107 17:7080755-7080777 ATGCCTCCCCAGGTGCTTGGGGG - Intergenic
1146242405 17:31242936-31242958 AAGGCTTTCCAAGTATTTGAAGG + Intronic
1149771091 17:59321593-59321615 GAGGCTTCCCAGGTATGGGGAGG + Intergenic
1151007257 17:70451909-70451931 CTGGATTCCTAGGTTTTTGGGGG + Intergenic
1151618898 17:75232985-75233007 TTGGCTTCCCAGGGACTGGGTGG + Intronic
1154931000 18:20995908-20995930 AAGGCTTTCCAGGTATTCGAAGG - Intronic
1155471617 18:26197627-26197649 CTGTAGTCCCAGGTATTTGGGGG + Intergenic
1155802922 18:30131612-30131634 ATGTATTCCCAAGTATTTTGTGG + Intergenic
1156084983 18:33387120-33387142 TTGTTTTCCCAGGTATTTTGTGG - Intronic
1156234663 18:35190553-35190575 AAGTCTACCCTGGTATTTGGAGG + Intergenic
1157879453 18:51305817-51305839 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1158024866 18:52884844-52884866 AAGGCTTTCCAGGTATTTGAAGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160686439 19:439022-439044 ATGGCTTCCCTGGGGTTGGGAGG + Exonic
1162224897 19:9212873-9212895 CTGTCTTCCCAGCTACTTGGAGG - Intergenic
1163208168 19:15819496-15819518 ATGGCTTCAGAGGGATATGGTGG + Intergenic
1164064435 19:21703500-21703522 CTGTAATCCCAGGTATTTGGAGG - Intergenic
1165645570 19:37432522-37432544 AAGACTTTCCAGGTATTTGAAGG - Intronic
1165897173 19:39149468-39149490 ATGGAGTCCCAGCTATTCGGGGG + Intronic
1166408186 19:42538800-42538822 AAGGCTTTCCAGGTATTTGAAGG + Intronic
1168058283 19:53875724-53875746 CTGTAATCCCAGGTATTTGGGGG + Exonic
925010329 2:480117-480139 CTTGATTCCCAGATATTTGGGGG - Intergenic
925714014 2:6768381-6768403 ATGGCTTCCCAGATGTCAGGGGG + Intergenic
926518955 2:13884839-13884861 AAGGCTTTCCAAGTATTTGAAGG - Intergenic
927570136 2:24152463-24152485 AAGGCTTTCCAGGTGTTTGAAGG + Intronic
928118466 2:28564710-28564732 CTGGCCTCCCAGGCAGTTGGGGG - Intronic
928700283 2:33891958-33891980 CTGCCTTCCCAGGTGGTTGGAGG + Intergenic
928863838 2:35894707-35894729 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
930812095 2:55553350-55553372 ATGGCTTCACAGGAGTATGGGGG + Intronic
930878181 2:56243780-56243802 AAGGCTTTCCAGGTATTTGAAGG + Intronic
930895317 2:56439712-56439734 AAGGCTTTCCTGGTATTTGAAGG + Intergenic
932921011 2:75915818-75915840 GAGGCTTTCCAGGTATTTGAAGG + Intergenic
934162669 2:89267305-89267327 ATGCCTTCTCTGGTTTTTGGTGG + Intergenic
934204605 2:89915219-89915241 ATGCCTTCTCTGGTTTTTGGTGG - Intergenic
935397280 2:102621211-102621233 ATGTATTCCCAGTTACTTGGAGG + Intronic
935437733 2:103055286-103055308 AAGGCTCTCCAGGTATTTGAAGG + Intergenic
936809760 2:116384037-116384059 TTAGCTTCCTAGGTCTTTGGGGG + Intergenic
937011258 2:118564902-118564924 ATGGCTGCCCAGGGATGGGGAGG - Intergenic
937527906 2:122793486-122793508 TTGGCTTACAAAGTATTTGGGGG + Intergenic
938997999 2:136701106-136701128 AGGACTTCCCAGGACTTTGGGGG - Intergenic
939001022 2:136734714-136734736 ATGGCCTATCAGGTATTTTGAGG + Intergenic
939028882 2:137046772-137046794 ATGGCCGCCCAGGTATTGGAAGG + Intronic
939144655 2:138397343-138397365 AAGGCTTTCCAAGTATTTGAAGG - Intergenic
939675021 2:145061893-145061915 ATGCATTACCTGGTATTTGGGGG + Intergenic
940402217 2:153261349-153261371 AGGACATTCCAGGTATTTGGAGG + Intergenic
940559691 2:155280315-155280337 AAGGCTTTCCAGGTATTTAAAGG + Intergenic
940795531 2:158072826-158072848 AAGGCTTTCCAGGTATTTGAAGG - Intronic
941745824 2:169086635-169086657 AAGTCTTTCCAGGTATTTGAAGG + Intronic
941748268 2:169109965-169109987 CTGGGATCCCAGGTATTTTGTGG - Intergenic
942814184 2:180033141-180033163 AAGGCTTTCCAGGGATTTGAAGG + Intergenic
942862032 2:180625737-180625759 ATGGAATCCCAGTTATTTTGTGG + Intergenic
943913233 2:193594274-193594296 AAGGCTTTCCTGGTATTTGAAGG - Intergenic
944078778 2:195760787-195760809 AAGGCTTTCCAGATATTTGAAGG - Intronic
944096848 2:195976992-195977014 AAGACTTTCCAGGTATTTGAAGG - Intronic
944963228 2:204900766-204900788 AAGGCTTTCCAGGTATTTGAAGG + Intronic
946508946 2:220334080-220334102 AAGGCTTTCCAAGTATTTGAAGG + Intergenic
947104467 2:226654165-226654187 AGGAGTTCCCTGGTATTTGGGGG - Intergenic
947728922 2:232417529-232417551 AGGTCATCCCAGGTATGTGGAGG + Intergenic
948196596 2:236101456-236101478 GTGGCTTCTCAGGGATTTGCTGG - Intronic
1168743945 20:219783-219805 AAGGCTTTTCAGGTATTTGAAGG - Intergenic
1169525350 20:6418467-6418489 AAGTCTTCCCAGCAATTTGGTGG + Intergenic
1169635728 20:7689470-7689492 AGGGCTACCCAAGTTTTTGGGGG + Intergenic
1171727342 20:28637127-28637149 ATGTCTTACCAAGCATTTGGGGG - Intergenic
1171728151 20:28646639-28646661 ATGTCTTACCAAGCATTTGGGGG + Intergenic
1171750904 20:29047489-29047511 ATGTCTTACCAAGCATTTGGGGG + Intergenic
1171792070 20:29536447-29536469 ATGTCTTACCAAGCATTTGGGGG - Intergenic
1172328296 20:34054701-34054723 CTGGCATCCCAGCTACTTGGGGG + Intronic
1172369987 20:34381737-34381759 ATGTAGTCCCAGCTATTTGGGGG + Intronic
1173740478 20:45396686-45396708 CTGTATTCCCAGCTATTTGGAGG - Intronic
1175724124 20:61305629-61305651 AGAGCTTCCCAGGGCTTTGGTGG + Intronic
1176313862 21:5223428-5223450 ATGTCTTACCAAGCATTTGGGGG - Intergenic
1178047923 21:28716358-28716380 ATGTATTCCTAGGTATTTTGTGG + Intergenic
1178239533 21:30882888-30882910 ATGGATTTCCATGTATTTGAGGG + Intergenic
1180391685 22:12289549-12289571 ATGTCTTACCAAGCATTTGGGGG - Intergenic
1180408059 22:12575205-12575227 ATGTCTTACCAAGCATTTGGGGG + Intergenic
1180912394 22:19460523-19460545 AGGTCTTCCCAGGTAGTTTGAGG - Intronic
1181362299 22:22347288-22347310 ATTGCTCCCCAGGCATCTGGGGG + Intergenic
1182567755 22:31212578-31212600 AGCGCTCCCCAGGCATTTGGAGG + Intronic
1184443646 22:44534542-44534564 ATGACTGCCCAGGAATTTGGAGG - Intergenic
949829107 3:8195963-8195985 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
950800928 3:15551396-15551418 AAGGCTTTCCAGGCATTTGAAGG + Intergenic
951029143 3:17862472-17862494 AAGGCTTTCCAGGTATTTGAAGG + Intronic
951208831 3:19952089-19952111 CTGTAGTCCCAGGTATTTGGAGG + Intronic
951494905 3:23315755-23315777 AAGGCTTTCCAGGTATTTGTTGG + Intronic
954666612 3:52257098-52257120 TTGGCTTCCCATGCAGTTGGAGG + Exonic
955117108 3:56016800-56016822 ATGGCTCCCCAGTTAATTAGTGG + Intronic
955147437 3:56334164-56334186 TTGGCATCCAAGGGATTTGGGGG - Intronic
955274221 3:57532482-57532504 AAGGCTTTCCAGGTATTTGAAGG + Intronic
955585083 3:60469790-60469812 AAGGCTTTCCAGGTATTTGAAGG + Intronic
955948028 3:64213974-64213996 ATGACTTGCCAGTGATTTGGGGG - Intronic
956844822 3:73172946-73172968 ATGGGAGACCAGGTATTTGGTGG - Intergenic
959158118 3:102691799-102691821 CTGGCTTCCAAGTCATTTGGAGG + Intergenic
959448143 3:106466371-106466393 AAGGCTTTGCAGGTATTTGAAGG + Intergenic
959547301 3:107612378-107612400 AAGGCTTTCCAGGTATTAGAAGG + Intronic
960862610 3:122167494-122167516 AAGGTTTCCCAAGTATTTGCAGG + Intergenic
960985837 3:123280105-123280127 ATGGCTTCCCAGGCCTGAGGAGG + Intergenic
961500533 3:127329880-127329902 AAGGCTTCCAAGGAACTTGGAGG + Intergenic
963537995 3:146552226-146552248 ATGGCTTCCCAGGTAGTTCTGGG + Intergenic
963996074 3:151709923-151709945 GAGGCTTTCCAGGTATTTGAAGG - Intergenic
964179539 3:153866283-153866305 AAGGTTTTCCAGGTACTTGGAGG - Intergenic
965059874 3:163772325-163772347 AAGGCTTTCCAGGTATTCGAAGG + Intergenic
966151822 3:176874470-176874492 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
966178986 3:177170725-177170747 CTGTATTCCCAGGTACTTGGTGG - Intronic
966726606 3:183114525-183114547 ATGGCTTGCTCGGTATTTGAGGG + Intronic
968730063 4:2265287-2265309 AGGGCTTCCCCGGTTTTGGGTGG + Intergenic
970351243 4:15203634-15203656 ATGGCTTTAGAGCTATTTGGTGG + Intergenic
971153481 4:24058509-24058531 ATGGCTGCCTGGGTATGTGGTGG - Intergenic
972579405 4:40381158-40381180 AAGGCTTTCCAGGTATGTGAAGG - Intergenic
972928568 4:44041673-44041695 AATGCTTTCCAGGTATTTGAAGG - Intergenic
973623454 4:52749678-52749700 ATGTCTTCCCAGCTACTCGGGGG + Intronic
974414846 4:61594451-61594473 AAGGCCTTCCAGGTATTTGGAGG + Intronic
976886323 4:89989229-89989251 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
977066545 4:92323600-92323622 CTGGCATCCCAGGTTTTTTGTGG + Intronic
977873547 4:102123068-102123090 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
978625178 4:110677222-110677244 AAACCTTCCCAGGTATTTGGAGG + Intergenic
979111522 4:116762852-116762874 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
980442636 4:132868195-132868217 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
980683051 4:136188202-136188224 ATGACTTTCCAGGTATTTAAAGG - Intergenic
980693120 4:136321157-136321179 AAGGCTTTTCAGGTATTTGAAGG - Intergenic
981140368 4:141260332-141260354 AAGGCTTTCCAGTTATTTGAAGG - Intergenic
981996293 4:150978389-150978411 AAGGCTTTCCAGGTATTTGAAGG - Intronic
982707785 4:158729107-158729129 GTGGCTTCCCAGGTATGTGACGG - Intergenic
983493246 4:168413034-168413056 AAGGCTTCCCAGGTATTTGGAGG - Intronic
985261307 4:188117623-188117645 AGCTCTTCCTAGGTATTTGGGGG - Intergenic
987904017 5:24051696-24051718 AAGGCTTTCCAAGTATTTGAAGG - Intronic
987953031 5:24701304-24701326 AGGACTTTCCAGGTATTTGGAGG + Intergenic
988384338 5:30540808-30540830 AAGGCCTTCCAGGTATTTGAAGG - Intergenic
988939495 5:36128268-36128290 AAGGCTTTCCAGGTATTTGAAGG - Intronic
989657582 5:43761199-43761221 AAGGCTTCCCAAGTATTTGAAGG + Intergenic
991156850 5:63447273-63447295 ATGTCTTTCTAGGTTTTTGGTGG + Intergenic
991395152 5:66197669-66197691 AAGGCCTTCCAGGTATTTGAAGG + Intergenic
991603573 5:68378147-68378169 AGAGGTTCCCAGGCATTTGGTGG + Intergenic
992934662 5:81688722-81688744 AAGGCTTTTCAGGTATTTGAAGG - Intronic
993206944 5:84894473-84894495 AAGGCTTCCCAGGTGTTTGAAGG + Intergenic
993981408 5:94546693-94546715 AATGCTTTCCAGGTATTTGAAGG - Intronic
994217712 5:97158267-97158289 AAGGCTTTCCAGGTATTTGAAGG + Intronic
994226357 5:97255212-97255234 AAGGCTGTCCAGGTATTTGAAGG - Intergenic
994344036 5:98664079-98664101 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
995265477 5:110153670-110153692 AAGGCTTTCCAGGTATTAGAAGG - Intergenic
997104843 5:131006560-131006582 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
997600520 5:135135417-135135439 AAGGCTTTGCAGGAATTTGGGGG - Intronic
998529044 5:142868373-142868395 ATGGCTTCCCAGAGCTCTGGAGG - Intronic
1000284467 5:159815148-159815170 ATGGCTTCCCAGAGTCTTGGGGG + Intergenic
1004469651 6:15917695-15917717 ATGGCTTATGAAGTATTTGGTGG + Intergenic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1005405080 6:25478167-25478189 ATTTTTTCCCAGCTATTTGGTGG + Intronic
1006114646 6:31769007-31769029 ATGGCTGCCCTGGTAAGTGGGGG - Exonic
1006419638 6:33925039-33925061 GTGGCTTCCCAGGAATCAGGTGG - Intergenic
1008940658 6:57041854-57041876 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1010062028 6:71634795-71634817 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1010182057 6:73097874-73097896 AAGGCTTTCCTGGTATTTGAAGG - Intronic
1010264623 6:73852437-73852459 ATGGCTTCTCAGGTATTCAAGGG + Intergenic
1011019101 6:82790269-82790291 AAGGCTTTCCAGATATTTGAAGG - Intergenic
1011236157 6:85219123-85219145 AAGGCTTTCCAGGTGTTTGAAGG - Intergenic
1011269941 6:85567858-85567880 CTGTATTCCCAGCTATTTGGGGG + Intronic
1012112338 6:95252422-95252444 TTGCATTCCCAGCTATTTGGGGG - Intergenic
1014127395 6:117792737-117792759 AAGGCTTTCAAGGTATTTGATGG - Intergenic
1014378955 6:120714508-120714530 AAAGCTTTCCAGGTATTTGAAGG - Intergenic
1016211280 6:141537602-141537624 GTGCCTTTCCAGGTATTTGGAGG + Intergenic
1016457230 6:144244321-144244343 AAAGCTTCCCAGGTATTTGAAGG + Intergenic
1016845711 6:148566186-148566208 AGGGCTCCACAGGTATTTGTTGG + Intergenic
1017243292 6:152195437-152195459 AAGGTTTTCCAGGTATTTGAAGG + Intronic
1017924679 6:158900899-158900921 AAGGCTTCCCAGTTATTTGAAGG + Intronic
1021884738 7:25127842-25127864 ATGGCTTTCCAAGTATTTGAAGG + Intergenic
1022012136 7:26317577-26317599 AATTATTCCCAGGTATTTGGTGG - Intronic
1022758798 7:33325627-33325649 AAGGCTTTCCAGGTATTCAGGGG + Intronic
1023452253 7:40299788-40299810 ATGGCTTCACTGGTATTTTTTGG + Intronic
1023716400 7:43047979-43048001 AAGGCTCTCCAGGTATTTGAAGG - Intergenic
1023901259 7:44481514-44481536 ATGGCTGTCAAGGTATTTTGTGG - Intronic
1024323835 7:48093494-48093516 AAGGCTTTCCAGGGAGTTGGGGG + Intronic
1025160606 7:56655938-56655960 AAGGCTTCCCAGGTATTCAAAGG - Intergenic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1027605030 7:80288990-80289012 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1031098618 7:117449707-117449729 AAGGCTTTCCAGGTATTTTGAGG - Intergenic
1031215389 7:118883557-118883579 AAGGCTTTCCAGGTATTTAAAGG - Intergenic
1032942576 7:136811485-136811507 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1036772013 8:11585608-11585630 CTGTAGTCCCAGGTATTTGGAGG + Intergenic
1037254953 8:16942620-16942642 GAGGCTTTCCAGGTATTTGAAGG - Intergenic
1039219812 8:35317649-35317671 CTGGCTTCCCAGGTCCATGGAGG - Intronic
1039841229 8:41294633-41294655 CTGGCTTGGCAGATATTTGGAGG - Intronic
1040485884 8:47870578-47870600 AAGACTTTCCAGGTATTTGTAGG - Intronic
1042162770 8:65913323-65913345 AAGGCTTTCCAGGTATTAGAAGG - Intergenic
1042428322 8:68674142-68674164 AAGGGTTTCCAGGTATTTGAGGG - Intronic
1043197232 8:77311307-77311329 ATGGCTTCTCTGGTAATTTGTGG + Intergenic
1043567476 8:81563283-81563305 AAGGCTTTCTAGGTATTTGAAGG - Intergenic
1045590090 8:103583279-103583301 AAGGCTTTCCAGATATTTGAAGG - Intronic
1045598896 8:103691833-103691855 AAAGCTTTCCAGGTATTTGAAGG + Intronic
1045995051 8:108352513-108352535 AAGGTTTTCCAGGTATTTGAAGG - Intronic
1046764409 8:118054228-118054250 ATGGCTTCCTAGCTAGTTTGGGG - Intronic
1046811445 8:118537941-118537963 AAGGCTTTCCAGGTATTGGAGGG + Intronic
1046885459 8:119361977-119361999 ATGGCATCCTTGGTATTTGTGGG + Intergenic
1047455762 8:125009330-125009352 ATTTCTTACCAGGTATTTGTGGG - Exonic
1047857927 8:128932892-128932914 ATGGCTTTCCATGAATTTGCTGG - Intergenic
1048334761 8:133494183-133494205 ATTGCTTCCCAGGCATATTGTGG - Intronic
1050238702 9:3612115-3612137 AAGGTTTTCCAGGTATTTGAAGG + Intergenic
1050316148 9:4402318-4402340 AAGGCTTTCCAGGTATTCGAAGG - Intergenic
1051890385 9:21936238-21936260 GTCGCTTCCAAGGTGTTTGGAGG + Intronic
1052647932 9:31261471-31261493 ATGGCATTCTAAGTATTTGGAGG + Intergenic
1053722401 9:40959976-40959998 ATGTCTTACCAAGCATTTGGGGG + Intergenic
1058218904 9:102271394-102271416 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1059657648 9:116370472-116370494 ATGGCTTACCAGGGATGTGCTGG + Intronic
1060083981 9:120680315-120680337 AAGGCTTTCCAGGTATTCGAAGG + Intronic
1060304638 9:122399412-122399434 AAGGCTTTCCAGGTATTCGAAGG - Intergenic
1185572561 X:1146028-1146050 ATGCGGTCCCAGCTATTTGGAGG - Intergenic
1186241299 X:7569560-7569582 ATGGCTTCCCAAATATTTACTGG - Intergenic
1187618241 X:21021396-21021418 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1187636968 X:21239277-21239299 AAGGCTTTCCAGGTATTGGAAGG - Intergenic
1188420987 X:29990991-29991013 AAGTCTTTCCAGGTATTTGAAGG + Intergenic
1188650859 X:32630971-32630993 AGGGCTTTCCAGGTATTTAAAGG + Intronic
1189875537 X:45432896-45432918 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1190132596 X:47763668-47763690 ATGTATTCCTAGATATTTGGGGG - Intergenic
1192304281 X:69943319-69943341 AGGGCTTTCCAGGTATTTGAAGG + Intronic
1192346578 X:70313732-70313754 ATGGATTCACAGGAAGTTGGTGG + Intronic
1192593303 X:72380118-72380140 TTAGATTCCCAGGTATTTGTTGG + Intronic
1192759371 X:74079551-74079573 AGGGCTTCCCTGGTCTTTTGTGG - Intergenic
1192959415 X:76111263-76111285 AAGGTTTGCCAGGTATTTGAAGG - Intergenic
1193052281 X:77114446-77114468 AAGGCTTTTCAGGTATTTGAAGG + Intergenic
1193098472 X:77579657-77579679 AAGGCTTTCCAGGTATTTGAAGG - Intronic
1193191005 X:78571665-78571687 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1193441174 X:81540293-81540315 AAGGATTTCCAGGTATTTGAAGG - Intergenic
1193742476 X:85233284-85233306 AAGGCTTTCCGGGTATTTGAAGG - Intergenic
1194479244 X:94400391-94400413 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1194577082 X:95626405-95626427 AATGCTTCTCAGGTATTTTGTGG - Intergenic
1194586214 X:95737076-95737098 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1195199928 X:102539051-102539073 AAGGCTTTCCAGGTATTTTAAGG + Intergenic
1195312421 X:103644215-103644237 AAGGCTTTCCAGGTATTTGAAGG - Intergenic
1195798523 X:108680740-108680762 CAGGATTCCCAGGTATTTGAAGG + Exonic
1196096600 X:111807715-111807737 AAGGCTTTCCAGATATTTGAAGG + Intronic
1196215981 X:113051695-113051717 AAGGTTTTCCAGGTATTTGAAGG - Intergenic
1196217459 X:113071001-113071023 AAGGCTTCCCAGGTATTAGAAGG + Intergenic
1196639382 X:118040104-118040126 AAGGCTTTCCAGGTATTTAAAGG - Intronic
1198770394 X:140124970-140124992 AAGGCTTTCCAGGTATTTGAAGG + Intergenic
1198947408 X:142030316-142030338 AAGGTTTTCCAGGTATTTGAAGG + Intergenic
1199393783 X:147310428-147310450 AAGGTTTTCCAGGTATTTGAAGG - Intergenic
1199485228 X:148339266-148339288 AAGGCTTCCCAGGTATTTGAAGG - Intergenic
1199649407 X:149938559-149938581 GTGGCTTCCTAGCGATTTGGCGG - Exonic
1200035206 X:153322111-153322133 ATGGCTGCCCAGGTGGTTGAAGG - Intergenic