ID: 1129412269

View in Genome Browser
Species Human (GRCh38)
Location 15:75356506-75356528
Sequence CCTAGAAGGGGCAGGAAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129412253_1129412269 22 Left 1129412253 15:75356461-75356483 CCAGGAAACAATGCTGGTGGAGA 0: 1
1: 0
2: 2
3: 29
4: 177
Right 1129412269 15:75356506-75356528 CCTAGAAGGGGCAGGAAGCCAGG 0: 1
1: 0
2: 2
3: 36
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129412269 Original CRISPR CCTAGAAGGGGCAGGAAGCC AGG Exonic