ID: 1129412269 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:75356506-75356528 |
Sequence | CCTAGAAGGGGCAGGAAGCC AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 429 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 36, 4: 390} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129412253_1129412269 | 22 | Left | 1129412253 | 15:75356461-75356483 | CCAGGAAACAATGCTGGTGGAGA | 0: 1 1: 0 2: 2 3: 29 4: 177 |
||
Right | 1129412269 | 15:75356506-75356528 | CCTAGAAGGGGCAGGAAGCCAGG | 0: 1 1: 0 2: 2 3: 36 4: 390 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129412269 | Original CRISPR | CCTAGAAGGGGCAGGAAGCC AGG | Exonic | ||