ID: 1129412348

View in Genome Browser
Species Human (GRCh38)
Location 15:75356884-75356906
Sequence TCCAGCGATGGGCCCACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129412343_1129412348 2 Left 1129412343 15:75356859-75356881 CCAAAGCCGTGTTCTGACAGATC 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
1129412341_1129412348 7 Left 1129412341 15:75356854-75356876 CCAGCCCAAAGCCGTGTTCTGAC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
1129412342_1129412348 3 Left 1129412342 15:75356858-75356880 CCCAAAGCCGTGTTCTGACAGAT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
1129412344_1129412348 -4 Left 1129412344 15:75356865-75356887 CCGTGTTCTGACAGATCCATCCA 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129412348 Original CRISPR TCCAGCGATGGGCCCACACC TGG Exonic
900122487 1:1054730-1054752 ACCAGCAGGGGGCCCACACCTGG - Intronic
900239929 1:1611424-1611446 TCCAGACATGGGCCCTCCCCAGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901458770 1:9378880-9378902 TCCAGCGCGGGGCACAGACCAGG + Intergenic
902362703 1:15950828-15950850 CCCAGCCTTGGGCCCACACAAGG - Intronic
907329751 1:53663275-53663297 TACAGGGCTGGGCCCACAGCAGG + Intronic
911463698 1:98223890-98223912 TACAGACATGAGCCCACACCTGG - Intergenic
911498124 1:98655222-98655244 TCCAGGCATGGACACACACCAGG - Intergenic
915529957 1:156497741-156497763 TCCAACCAAGGGCCCACACCAGG + Intronic
916056478 1:161072133-161072155 TCCAGCTATGCCCGCACACCTGG + Exonic
918972244 1:191434045-191434067 TCCAGCAATGGATCCAAACCAGG + Intergenic
1062791892 10:312103-312125 TCCAGCGCTGGGCTCTCACACGG + Intronic
1065903353 10:30227376-30227398 TTCAGCGAAGGGCCCAGCCCTGG - Intergenic
1078107266 11:8366181-8366203 TCCCCTGATGGGCCCACTCCAGG - Intergenic
1084334748 11:68450141-68450163 CGCAGGGATGGGCCCACAGCAGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1086116350 11:83255092-83255114 TCCAGCCATGGGCTCTCCCCAGG + Intronic
1088166942 11:106950429-106950451 TTCAGCTCTGTGCCCACACCTGG + Intronic
1089092282 11:115888053-115888075 GCCAGCCATGGCCCCATACCTGG + Intergenic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1093489425 12:19688072-19688094 TCCAGTGATCGGCCCACCCCAGG - Intronic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1101588779 12:106108350-106108372 TCCAGCCATGGGTCCACCCAGGG - Intronic
1102428608 12:112863931-112863953 TCCAGCACTGGGCACACAGCAGG + Intronic
1102515260 12:113441931-113441953 CCCAGAGCTGGGCCCACACAGGG + Intergenic
1103194427 12:119029930-119029952 TCCAGCTAATGGCCCATACCTGG + Intronic
1104377967 12:128281735-128281757 GCCAGAGATGGGCCCAAACAAGG - Intronic
1104741522 12:131178409-131178431 TCCAGCAATGGATCCAAACCAGG + Intergenic
1112389083 13:98966276-98966298 ACCGGCCATGGGCCAACACCAGG + Intronic
1113626243 13:111849951-111849973 TACAGTGATGGGCAAACACCAGG - Intergenic
1115300354 14:31878598-31878620 TCAAGCGATGGGCCCCCCCATGG + Intergenic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1123124911 14:105939650-105939672 ACCAGCGCAGGGCCCAGACCAGG - Intergenic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1128229544 15:66025041-66025063 TCCAGTGAGGGGCTCACTCCAGG - Intronic
1128246518 15:66136347-66136369 TCCAGCCAAGAGCCCACACTAGG + Intronic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1129718603 15:77865761-77865783 ACCAGGGCTGGGCACACACCAGG + Intergenic
1130554776 15:84915017-84915039 TGCAGGGATGGGCCCACGCCAGG - Intronic
1132026712 15:98410011-98410033 TCCAGAGTTGGGACCAAACCTGG + Intergenic
1132227661 15:100154971-100154993 TCCAGCGATGGGCGCACAGTGGG - Intronic
1132236713 15:100227562-100227584 TCCAGCGATGTGCCATCACTGGG - Intronic
1136585051 16:31179477-31179499 TCCAGCACTGGGCTCTCACCCGG - Intergenic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1143730589 17:8880621-8880643 TCTGGCGCTGGGCCCACACTAGG + Exonic
1144763004 17:17717856-17717878 TCCAGTGAAGGGTCCACAGCAGG + Intronic
1148736461 17:49867943-49867965 ACCAGAGATGGGCCCACATGGGG + Intergenic
1151182349 17:72338439-72338461 TGGAGAGAAGGGCCCACACCTGG + Intergenic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1163692640 19:18745749-18745771 GCCAGCGCTGGGGCCACAGCTGG + Intronic
1165008260 19:32823908-32823930 TCCCCCGAGGGCCCCACACCAGG - Intronic
1167044334 19:47040962-47040984 TCCAGCACTGGGCCCAGCCCAGG - Exonic
1167932027 19:52873756-52873778 TCCTGGGAAGGGCTCACACCAGG - Intronic
1168103928 19:54155460-54155482 TCCAGGGCAGGGCCCTCACCTGG - Exonic
1168137359 19:54360450-54360472 TCCAGGGATGGCCCCTGACCAGG - Intronic
1168160718 19:54508635-54508657 TCCAGGGATGGCCCCTGACCAGG + Intronic
1168648542 19:58077548-58077570 TCCTGGGATGGGGCCACACTTGG - Intronic
931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG + Intergenic
931711533 2:64992204-64992226 TCCTGCTATGGTCCCGCACCGGG + Intronic
933100059 2:78244093-78244115 TCCTGAGAAGGGCCCCCACCAGG + Intergenic
938540676 2:132281338-132281360 TGGAGCGTTGGGCCCATACCCGG - Intergenic
942787677 2:179719164-179719186 TCCACCCATGAGCCCACCCCAGG + Intronic
947774450 2:232697038-232697060 TCCAGGGTTGGGCCCGGACCAGG - Intergenic
949023811 2:241755604-241755626 TCCAGGGTTGGAGCCACACCTGG + Intronic
1168962927 20:1881236-1881258 TCCAGAGAAGGACTCACACCTGG - Intergenic
1179681498 21:43024558-43024580 TCCAGCGGTGAGTCTACACCAGG - Intronic
1180758820 22:18183298-18183320 TCCACCCCTGGGCACACACCAGG + Intergenic
1180769107 22:18367089-18367111 TCCACCCCTGGGCACACACCAGG + Intergenic
1180777205 22:18495306-18495328 TCCACCCCTGGGCACACACCAGG - Intergenic
1180809925 22:18752615-18752637 TCCACCCCTGGGCACACACCAGG - Intergenic
1180826982 22:18870318-18870340 TCCACCCCTGGGCACACACCAGG + Intergenic
1181030110 22:20145507-20145529 CCCGCCGATGGGTCCACACCAGG - Intronic
1181196068 22:21186867-21186889 TCCACCCCTGGGCACACACCAGG - Intergenic
1181213459 22:21306257-21306279 TCCACCCCTGGGCACACACCAGG + Intergenic
1181437062 22:22917237-22917259 TCAGGTGATGGGCCCAGACCAGG + Intergenic
1181513159 22:23397806-23397828 CCCGCCGATGGGTCCACACCAGG + Intergenic
1182085035 22:27555621-27555643 TCCAGGGATGGCCCCACCACAGG + Intergenic
1183503998 22:38198864-38198886 TCAAGAGCTGGGGCCACACCTGG - Intronic
1183663687 22:39235454-39235476 TCCCTGGCTGGGCCCACACCTGG + Intronic
1183740584 22:39666585-39666607 GCCAGCCAAGGGCCCTCACCTGG - Intronic
1183976418 22:41515016-41515038 TCCTGTGATGGGCCCAGGCCCGG - Intronic
1203230730 22_KI270731v1_random:107974-107996 TCCACCCCTGGGCACACACCAGG + Intergenic
1203277124 22_KI270734v1_random:96223-96245 TCCACCCCTGGGCACACACCAGG + Intergenic
950595304 3:13975260-13975282 TCCAGCAATGGATCCAAACCAGG - Intronic
950672873 3:14537720-14537742 TCCTCCGAGGGGCCCTCACCAGG - Intronic
952889291 3:38029923-38029945 CCCAGCGAGGCGCCCACAACAGG - Intergenic
952959582 3:38581006-38581028 CACAGCGATGGGCACACACACGG + Exonic
954534106 3:51345163-51345185 TTCAGCAATGGACCCACAACAGG - Intronic
956332462 3:68126591-68126613 TCCTGTTATGGGCCCACCCCAGG + Intronic
961606631 3:128100303-128100325 TCCAGCAGTGGGCTCACACCTGG - Intronic
962265971 3:133944614-133944636 GCCAGCCATGTGGCCACACCTGG + Intronic
972667162 4:41177611-41177633 TGCAGCGATGGACACACACCTGG + Intronic
976889797 4:90032778-90032800 ACCAGCTATAGGCCAACACCTGG - Intergenic
980596138 4:134957214-134957236 TCCAGCGATTGGCCCATCTCAGG - Intergenic
986055169 5:4129467-4129489 TCCAGAGAGGGTCCCACACGTGG + Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
1002139959 5:177132661-177132683 CCCAGCGCTGAGCCCACCCCCGG - Intergenic
1002701545 5:181128415-181128437 TGCAGAGATGGGTCCACCCCAGG - Intergenic
1004069756 6:12287903-12287925 GCCAGCCATCCGCCCACACCTGG - Intergenic
1004427013 6:15513523-15513545 TCCAGAGATGGGAGCACAGCAGG - Intronic
1017046039 6:150348004-150348026 TCCCGCGCTGTGCCCACCCCAGG - Intergenic
1018908568 6:168089063-168089085 CCCAGGGCTGGCCCCACACCAGG + Intergenic
1019291592 7:253152-253174 TCCAGCGATGGACCCAGTTCGGG + Intronic
1019492533 7:1321995-1322017 TACAGCGATGGTCCCAACCCTGG - Intergenic
1023744466 7:43310019-43310041 TCCAGTGATAGACCCACAGCTGG + Intronic
1042896948 8:73680588-73680610 ACCAGCGATGGATCCAAACCAGG + Intronic
1044760970 8:95517164-95517186 TCCAGAGCTGGTGCCACACCAGG - Intergenic
1045968627 8:108054877-108054899 TCAAGCGATCTGCCCACCCCAGG - Intronic
1046271656 8:111904634-111904656 TGAAGGGATGGGCCTACACCTGG + Intergenic
1050608457 9:7326228-7326250 TCCAGAGCTGGGCACACTCCAGG + Intergenic
1052835394 9:33246401-33246423 TCCAGCCATAGGCACACACGTGG + Intronic
1052851597 9:33381578-33381600 ACCAGGGAAGGGCCCACAGCTGG - Intergenic
1185669165 X:1792180-1792202 GCCAGCAATGGGTCCACAACTGG - Intergenic
1193865568 X:86726358-86726380 TCTGGTTATGGGCCCACACCTGG - Intronic
1197907612 X:131442990-131443012 TTCAGAGATGGGCCATCACCAGG - Intergenic
1199029824 X:142984318-142984340 TCCTGCCATGAGCCCACACAAGG + Intergenic
1200160586 X:154006191-154006213 TGCTGCGATGGCCCCACACCAGG - Intergenic