ID: 1129412540

View in Genome Browser
Species Human (GRCh38)
Location 15:75358131-75358153
Sequence GGAGACTGCTTGTGTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129412540_1129412547 -1 Left 1129412540 15:75358131-75358153 CCTGTTCCACACAAGCAGTCTCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412540_1129412544 -10 Left 1129412540 15:75358131-75358153 CCTGTTCCACACAAGCAGTCTCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1129412544 15:75358144-75358166 AGCAGTCTCCCCAGCCAGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129412540 Original CRISPR GGAGACTGCTTGTGTGGAAC AGG (reversed) Intronic
902669260 1:17961270-17961292 GGTGGCTGCTTCTGTAGAACCGG + Intergenic
903276087 1:22222742-22222764 GGAGACTGCTTGTGAGGGATTGG - Intergenic
903377602 1:22876509-22876531 GGGGCCTGCTTGTCTGGAGCAGG - Intronic
904692854 1:32307667-32307689 GGACAGTGATTGTGTGTAACTGG + Intronic
908396397 1:63729133-63729155 CGAGAGGGCTTGTGTGTAACTGG + Intergenic
911146733 1:94559659-94559681 GGAGACTGCTTGTCAGGCAAAGG - Intergenic
913550195 1:119910089-119910111 GGAGACTGCTGCTGTAGAGCAGG - Intergenic
914416790 1:147491364-147491386 GGACCATGCTTCTGTGGAACTGG + Intergenic
915866156 1:159501188-159501210 GGAGAGTGCTTGAGTAAAACAGG - Intergenic
916356663 1:163917378-163917400 GGAGTCTTCTTGTGGGGAAAAGG - Intergenic
1063733000 10:8720879-8720901 GGAGTCTCATTGTGTGGCACAGG + Intergenic
1066301721 10:34103211-34103233 GAAGCCTGCCTGTGAGGAACTGG + Intergenic
1072598248 10:96896316-96896338 GTTGACTGCTTGTGAGGAATGGG + Intronic
1075293581 10:121252560-121252582 GGAGACAGCCTGTGTTTAACGGG - Intergenic
1075471299 10:122692034-122692056 AGAGACAGCATGTGTGGAAATGG - Intergenic
1077461689 11:2714031-2714053 GGAGACTGCCTGTGTGGGGGAGG - Intronic
1077514330 11:2992541-2992563 GGAGACCGCGTGTGTGGTTCCGG + Intergenic
1079236417 11:18693893-18693915 GGAGAATGTTTGGGTGGAACTGG - Intronic
1080228443 11:29987580-29987602 GAAGGCTGCTTTTGTGGAGCAGG - Intergenic
1083190928 11:61052083-61052105 GGAGATGGCTTTTTTGGAACAGG - Intergenic
1086905734 11:92416040-92416062 GGAGACTGCCTGTGTGGAGATGG - Intronic
1090656102 11:128846854-128846876 TGAGATTGCTTGTGTTTAACAGG - Intronic
1093057515 12:14569310-14569332 GGAGTCTCCCTGTGTGGCACAGG - Intergenic
1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG + Intronic
1103975477 12:124699971-124699993 GGAGACTGCAGGCGTGGAGCGGG - Intergenic
1105810353 13:23990068-23990090 AGAGACTGTTTAGGTGGAACTGG - Intronic
1106633106 13:31497893-31497915 GTAGACTGTTTTTGTGGTACTGG + Intergenic
1110276545 13:73647554-73647576 GGTGACTGCTTGTGGGTAAGGGG + Intergenic
1114221923 14:20704412-20704434 GGGGAGTGCTAGTGTGGAAGCGG - Intergenic
1115160617 14:30389769-30389791 GGTGACAGGCTGTGTGGAACAGG + Intergenic
1118437339 14:65783830-65783852 GGAAACTGACTGTGTGGACCTGG + Intergenic
1119645758 14:76347091-76347113 GGAGACTGCTTGTTTCCAAGAGG - Intronic
1120663715 14:87280569-87280591 AGAGACTGGTTTTGTGGAAAAGG - Intergenic
1121110250 14:91307668-91307690 GAAGAGTGCGTGTGTGGAAGGGG + Intronic
1121571717 14:94951420-94951442 GCAGTCTGCTTGTGGGGAAGAGG - Intergenic
1122302257 14:100737859-100737881 TGACACTGCTTCTGTGGCACGGG - Exonic
1125016616 15:34943954-34943976 GGAGACTGGTTATATGGAATTGG - Intronic
1125692279 15:41605852-41605874 GGAGACTGATGGTCTGGAAGAGG + Intergenic
1128028301 15:64458454-64458476 GGATAGTGCTTGTCTGGAGCAGG + Intergenic
1128809138 15:70557320-70557342 GGAGACTGCCCCTGTGGTACTGG + Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1131678283 15:94694234-94694256 GGAGTCTGCATATGTGCAACTGG - Intergenic
1132090791 15:98946622-98946644 GCAGACTGCTCGGGTGGAATGGG + Intronic
1134380738 16:13722977-13722999 GGAGACTACGTATGTAGAACTGG - Intergenic
1135309392 16:21393445-21393467 GGAGTCTCCTAGTCTGGAACTGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136148969 16:28333758-28333780 GGAGTCTCCTAGTCTGGAACTGG - Intergenic
1136306135 16:29372569-29372591 GGAGTCTCCTAGTCTGGAACTGG - Intergenic
1139508769 16:67414371-67414393 GGTCTCTGCTTTTGTGGAACTGG - Intronic
1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG + Intergenic
1145849500 17:28078429-28078451 GAAGACTGTGTGTGTGGCACAGG - Intronic
1153921234 18:9792214-9792236 GGACACTGCTGGTCAGGAACGGG + Exonic
1153926128 18:9836740-9836762 GGAGACTCAGTGTGAGGAACAGG + Intronic
1157654129 18:49368834-49368856 GGAAACTGCTTGTGTTAGACAGG + Intronic
926439297 2:12870914-12870936 AGAAACTGCTTGTCTGGAAGTGG - Intergenic
929961762 2:46502524-46502546 GGAGACTGCTTTTGAGGACAAGG - Intronic
930672729 2:54168398-54168420 GGAGTCTGCTTCTGTGGCCCAGG - Intronic
931489296 2:62726324-62726346 GGAGACTGGGTGAGTTGAACTGG - Intronic
934084101 2:88495142-88495164 GTAGACTGCTTTTGTAGAAAGGG + Intergenic
937631169 2:124102648-124102670 GGAGACTCCTTTATTGGAACTGG - Intronic
941693549 2:168527104-168527126 GGAGGCTGCTTGGCTGGAAGAGG + Intronic
942408606 2:175682969-175682991 TGAGACTGCTTGTGAGTTACTGG - Intergenic
944225673 2:197346563-197346585 GGAGGCCCCTGGTGTGGAACAGG - Intergenic
946071280 2:217036205-217036227 GAAGAATGCTTGTCGGGAACCGG + Intergenic
948366480 2:237458142-237458164 GGAGAATGCTTCCATGGAACTGG - Intergenic
1170239377 20:14146444-14146466 GGTTGCTGCTTGTGTGGATCAGG + Intronic
1170716951 20:18840104-18840126 GGAGTCTGCCTTTGTGAAACAGG - Intergenic
1170745161 20:19092488-19092510 GAAGACTGGCTGTGTGGATCTGG + Intergenic
1172184646 20:33023743-33023765 GGAGACTGCATGTAGGGAACTGG - Intergenic
1173101380 20:40091878-40091900 GGAGAATGGTTTTGTGGATCAGG - Intergenic
1173225538 20:41160389-41160411 AGAGACTGGATGTGTAGAACTGG + Intronic
1175352538 20:58335212-58335234 AGAAACGGCTTGTGTGGAATGGG + Intronic
1184488348 22:44795242-44795264 GCAGGATGCTTGTGAGGAACAGG + Intronic
1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG + Intergenic
953636386 3:44668695-44668717 GGAGACTGGTTATGTGGACTGGG - Intergenic
954437192 3:50502665-50502687 GGACACTGCCTCTGTGGCACTGG + Intronic
963851146 3:150211533-150211555 GGAAAATTCTTGTTTGGAACAGG - Intergenic
968701946 4:2061525-2061547 GGAGAGGGCTTGTGTGGCAGGGG + Intronic
969644536 4:8419818-8419840 GGTGACTGGCAGTGTGGAACTGG - Intronic
978336939 4:107679260-107679282 GAAGACTCCTTCTGTGGTACAGG + Intronic
980009854 4:127582429-127582451 GGAGAGTGCTGGAGTGCAACAGG - Intergenic
982269048 4:153568154-153568176 TGAGAATGCTTCTGTGGAATGGG + Intronic
982388294 4:154836737-154836759 TGAGACTGCTTGGCTGGAAGGGG - Intergenic
983618175 4:169730894-169730916 CCAGACTGCTTGTGTGAACCTGG + Intronic
985733375 5:1563887-1563909 GGAGACTGCTTCTGCAGAGCAGG - Intergenic
989432412 5:41371349-41371371 GGAGATTGCTTATGTCCAACAGG - Intronic
989489486 5:42033276-42033298 GGTGACTCCTAGTGTTGAACTGG - Intergenic
995530785 5:113090118-113090140 GCAGAGTGCCTGTGTGGAGCTGG + Intronic
995773793 5:115702284-115702306 GGATACTGCTTGTGAGGATGTGG - Intergenic
1000395593 5:160771834-160771856 GGAGACAGTATGTGTGAAACAGG - Intronic
1000849947 5:166327915-166327937 GTAGCCTGCTGGTGGGGAACAGG + Intergenic
1002082510 5:176745894-176745916 GGGGACTGGGTGTGTGGAAGGGG + Intergenic
1003516559 6:6823392-6823414 GGAGTCTTGCTGTGTGGAACAGG - Intergenic
1008658779 6:53644210-53644232 TGGGACTGCTTGTTTTGAACAGG - Intergenic
1011551084 6:88531463-88531485 GGAGACTTCCTGTGTGAACCTGG - Intergenic
1014865920 6:126530023-126530045 GGACTCTGCTTGAGTGGAAGTGG - Intergenic
1015983001 6:138857764-138857786 GGAGAGTGCGTATGTGGAAAAGG - Intronic
1024927530 7:54633158-54633180 GGAGGCTGCTTACGTGGCACAGG - Intergenic
1026463104 7:70631901-70631923 GGAGACTGCCTGTGGTGAAAAGG + Intronic
1039798648 8:40935996-40936018 GGTGTCTCCTTGTGTGAAACGGG - Intergenic
1040809046 8:51430020-51430042 GGAGACTTCTTGATTGGATCAGG - Intronic
1043020073 8:74989150-74989172 GCAGGCTGGTTGTGGGGAACTGG + Intronic
1044892920 8:96856203-96856225 GGACACAGATTGTGTGGAGCAGG + Intronic
1048919996 8:139219503-139219525 GGGGAGTGTTTGTGTGGAAGTGG - Intergenic
1052772030 9:32698784-32698806 GGACACTGCTCTGGTGGAACCGG + Intergenic
1059413946 9:114151774-114151796 GAAGACTGCTTGTGGGGAGACGG + Intergenic
1059969501 9:119650746-119650768 GAAGACTGCTTCTGTGGGAGAGG + Intergenic
1061601753 9:131674967-131674989 GGAGTCTGCTTCTGGGGAACCGG - Intronic
1062716475 9:138012936-138012958 AGAGACAGCTCCTGTGGAACAGG + Intronic
1189302429 X:39961671-39961693 GGAGAATGGTTGTGTGGGAAGGG - Intergenic
1192307763 X:69981285-69981307 TGAGATTGCTTTTGTGGTACAGG - Intronic
1193213542 X:78836611-78836633 GTAGTATGCATGTGTGGAACTGG - Intergenic
1196003303 X:110809133-110809155 GGAGACTGATCCTGTGGGACTGG - Intergenic
1200169777 X:154064212-154064234 GCAGACTCCTTGTGTGGAGGGGG - Intronic