ID: 1129412547

View in Genome Browser
Species Human (GRCh38)
Location 15:75358153-75358175
Sequence CCCAGCCAGGGAGGAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 494}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129412538_1129412547 4 Left 1129412538 15:75358126-75358148 CCCAGCCTGTTCCACACAAGCAG 0: 1
1: 0
2: 1
3: 12
4: 174
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412541_1129412547 -7 Left 1129412541 15:75358137-75358159 CCACACAAGCAGTCTCCCCAGCC 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412535_1129412547 14 Left 1129412535 15:75358116-75358138 CCTCTTCCTCCCCAGCCTGTTCC 0: 1
1: 0
2: 10
3: 145
4: 1502
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412539_1129412547 3 Left 1129412539 15:75358127-75358149 CCAGCCTGTTCCACACAAGCAGT 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412537_1129412547 5 Left 1129412537 15:75358125-75358147 CCCCAGCCTGTTCCACACAAGCA 0: 1
1: 1
2: 0
3: 16
4: 260
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412536_1129412547 8 Left 1129412536 15:75358122-75358144 CCTCCCCAGCCTGTTCCACACAA 0: 1
1: 0
2: 0
3: 26
4: 412
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494
1129412540_1129412547 -1 Left 1129412540 15:75358131-75358153 CCTGTTCCACACAAGCAGTCTCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG 0: 1
1: 1
2: 1
3: 47
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129412547 Original CRISPR CCCAGCCAGGGAGGAGTCCA AGG Intronic
900393115 1:2442440-2442462 GGGAGCCAGGGAGGAGGCCAGGG - Intronic
900518585 1:3095028-3095050 CCCAACCGGGGAGTAGGCCAGGG - Intronic
900545912 1:3229148-3229170 AGCAGCCAGGGAGGAGCCCAGGG + Intronic
900671173 1:3855947-3855969 CCCAGGCAGCGATGACTCCATGG + Intronic
900919089 1:5659447-5659469 CCCACACAGGGAGGACACCACGG - Intergenic
901110031 1:6786142-6786164 CCCGCTCAGGGAGGTGTCCACGG - Intronic
901667665 1:10835758-10835780 CCCAGACAGGCAGGAGTTCGGGG + Intergenic
901782237 1:11601799-11601821 ACCTTCCAGGGAGGAGCCCAAGG + Intergenic
902037871 1:13470712-13470734 CCCAGGGAGCAAGGAGTCCATGG - Intergenic
902376913 1:16034282-16034304 CCCAGCCAAGCAGGAGACTAGGG - Intergenic
902382084 1:16057540-16057562 CCCAGCCAAGCAGGAGACTAGGG - Intergenic
902827636 1:18987929-18987951 CCCCACCAGGAAGGAGTCCTGGG + Intergenic
903101790 1:21036073-21036095 CTCAGCCAGAGAGGAGGCCCTGG - Intronic
903176575 1:21585134-21585156 CCCGGCCATGGACAAGTCCAAGG + Intergenic
903364209 1:22795983-22796005 CCCACCCAGGGCAGAGACCAAGG + Intronic
903383044 1:22909906-22909928 CCCAGCCAGGCTTGAGGCCATGG + Intronic
903626427 1:24733881-24733903 CCCAGCTACAGAGGAGGCCAAGG - Intergenic
903937654 1:26907719-26907741 CCCAGCCAGGGATGACTCACTGG - Intronic
904927424 1:34059874-34059896 ACCAGCCAGGCAAGAGTCCAAGG - Intronic
904935531 1:34127283-34127305 GGCAGCCAGAGAGGAGTTCAGGG + Intronic
905548683 1:38818876-38818898 CGCGGCCAGGGAGGAGGCCCCGG - Intergenic
905692134 1:39951282-39951304 CCCAGCTAGTCAGGAGCCCAAGG - Intergenic
906123438 1:43411095-43411117 CCCAGCAAAGGGGGAGTCCTTGG + Intronic
907253684 1:53161343-53161365 CCCACCCAGAGAGGAGTGGAGGG + Intergenic
907285614 1:53377627-53377649 CTCAGGCAGGAAGCAGTCCAAGG - Intergenic
907420719 1:54345400-54345422 CCCATCCAGGGAAAAGACCAAGG + Intronic
907514991 1:54988241-54988263 CCCAGCCAGGCGTGAGTGCAGGG + Intronic
907547249 1:55273158-55273180 CCCAGCCAGGGAGGTATCAGTGG - Intergenic
909587075 1:77301990-77302012 GTCAGCCAGGGTGGAGTGCAGGG + Intronic
910497810 1:87852593-87852615 CCCAGCAAGGGTGGAGTGGATGG + Intergenic
911644269 1:100321564-100321586 ATCAGCCAGGGAGTAGTCTATGG - Intergenic
912437113 1:109669406-109669428 CCAAGCCGAGGAGGAGGCCACGG - Intronic
912565130 1:110582143-110582165 CCCAGCCAGGGAAGGATTCATGG + Intergenic
913293444 1:117296374-117296396 CCCAGCCAAGGAGAAGAACATGG - Intergenic
914339618 1:146748918-146748940 CCCAGCCAGGAAGGTATCAATGG - Intergenic
914408340 1:147400248-147400270 CCCAGCCAGGGTGGTATCAATGG - Intergenic
915032552 1:152895996-152896018 TGCAGTCAGGGAGGAGTCCAAGG - Intergenic
917852841 1:179080135-179080157 CCCAGCCATGGAGGAGGCTCTGG - Intergenic
917931962 1:179828804-179828826 CCCAGCCAGTGGAGACTCCAGGG + Intergenic
918148497 1:181778769-181778791 AGCAGCCAGGGAGGAAGCCATGG - Intronic
920232111 1:204477617-204477639 GCCAGAGAGGGAGGAGCCCAGGG + Intronic
921185427 1:212665679-212665701 CCCGGCTGGGGAGGAGCCCAGGG - Intergenic
921294737 1:213691141-213691163 CTGAGCCAGGGAGGCTTCCACGG - Intergenic
922796828 1:228343618-228343640 GCCAGCCAGGGAGAAGCCAACGG + Intronic
923705356 1:236339768-236339790 CCCAGCTACTGAGGAGGCCAAGG + Intergenic
1063127925 10:3151849-3151871 CCCAGCCACGTAGGAGGCTAAGG - Intronic
1063299218 10:4836607-4836629 CTCGGACAGGGAGGAGTCCCAGG + Intronic
1063848159 10:10154830-10154852 CCCAGCTATGTAGGAGGCCAAGG + Intergenic
1064221260 10:13442126-13442148 CCCAGCCACGGAGGGGTTAACGG + Intronic
1064387298 10:14907975-14907997 CCCAGCTACGCAGGAGGCCAAGG - Intronic
1065078451 10:22103960-22103982 CCCAGAAAGGGAGGAGCACAAGG + Intergenic
1065850764 10:29785685-29785707 TCCAGCCAGGGAGGAATCAGTGG + Intergenic
1066100383 10:32112597-32112619 CCCAGCAACTTAGGAGTCCAGGG + Intergenic
1066497925 10:35960291-35960313 CCCAGACAGGGAGGCGTTTAAGG + Intergenic
1066783733 10:38979643-38979665 CCCAGCCGGGGATCAGGCCAAGG - Intergenic
1067730347 10:48806075-48806097 ACCAGGCAGGGAAGGGTCCAGGG - Exonic
1069797354 10:71061886-71061908 CCCTGCCCTGGAGGAGTCCCCGG - Intergenic
1070008713 10:72451580-72451602 CTCACCCAGGCTGGAGTCCATGG + Intronic
1070250077 10:74765924-74765946 TCCAGCCAGGGAGGAGGACGAGG + Intergenic
1070487049 10:76941403-76941425 CACAGGCTGGGAGGAGCCCAAGG + Intronic
1070569626 10:77631323-77631345 CACAGTCAGGGAGCAGACCAAGG - Intronic
1071484426 10:86089257-86089279 CCCAGCCAGGGAAGGGTCAGTGG + Intronic
1073045865 10:100637878-100637900 TCCAGGCTGGGAAGAGTCCAGGG + Intergenic
1073312072 10:102550098-102550120 TCCAGTCAGGTAGGAGGCCAGGG + Exonic
1073327483 10:102651062-102651084 GCCAGCCAGGGAGGAGTCCGGGG - Intronic
1073431640 10:103491139-103491161 CCCTGCCAGGGAGGAGTTGCTGG + Intergenic
1073449283 10:103600201-103600223 CCCAGCGAAGGGGGAGTCCTTGG + Exonic
1074126180 10:110530463-110530485 CCCAGCCAGGGCGGGCTCCGAGG + Intergenic
1075346213 10:121683680-121683702 ACCAGCAAGGGAGGAGGGCAGGG - Intergenic
1076703788 10:132290160-132290182 CCCAGCCAGAAAGGAGAGCAGGG + Intronic
1076808053 10:132869163-132869185 CCCAGAGGGGCAGGAGTCCAGGG + Intronic
1076898586 10:133325949-133325971 CGCAGCCAAGGAGGAGCGCAAGG - Exonic
1077005836 11:355777-355799 CTCAGGCAGGGAGGTGGCCAAGG + Intergenic
1077235724 11:1481176-1481198 TCCAACCAGGGAGGGGCCCAGGG + Intronic
1077303605 11:1858173-1858195 CCCAGGCAGGGAGCAGCCCTTGG - Intronic
1077307855 11:1875941-1875963 CCCAGGGAGGGGGCAGTCCAGGG - Intronic
1078333365 11:10444340-10444362 TACAGCCAGGGAGGACTCCTGGG + Intronic
1078841404 11:15078753-15078775 CAGAGGCAGGGAGAAGTCCAAGG + Intronic
1079163517 11:18015058-18015080 CCCAACCCTGGAGGAGTCCCAGG + Intergenic
1079756774 11:24274356-24274378 TCCAGCCACGCAGGAGCCCACGG + Intergenic
1080347145 11:31337624-31337646 CTCACCCAGGCAGGAGTGCAGGG - Intronic
1080695243 11:34597948-34597970 CCCAGTAAGGGATGAGTACAGGG + Intergenic
1080779152 11:35414972-35414994 CACAGCCATGGAGGAGGGCAGGG + Intronic
1081235610 11:40643692-40643714 CCCAGCCAGGGAGGTATCAATGG + Intronic
1081965302 11:47165627-47165649 CCCGGTGAGGCAGGAGTCCACGG + Intronic
1082066035 11:47901109-47901131 CCCAGCCAGGACGGATTGCAGGG + Intergenic
1082788408 11:57330429-57330451 CCTAGCCAGGGAAGAGTTCACGG + Exonic
1083260181 11:61518488-61518510 CTCAGCCAGGGAGGGGTCCCAGG - Exonic
1083640895 11:64144722-64144744 CCGGGCCAGCGACGAGTCCAGGG - Intronic
1083815420 11:65130025-65130047 CCCATCCAGGGAGGAGGGAAGGG + Exonic
1083841251 11:65305556-65305578 CCCAGCCACGCAGGAGGCCAAGG + Intronic
1084191920 11:67503396-67503418 CCCAGAGAGGGAGGGGGCCAGGG - Intronic
1084337904 11:68471839-68471861 TCCTACCAGGGAGGAGCCCATGG - Intronic
1084900901 11:72309056-72309078 CCCAGACAGGAAAGAGTCCAGGG - Intronic
1085025665 11:73235067-73235089 CCCAGCCAGGAAGTAGAGCACGG - Exonic
1085344795 11:75761717-75761739 CCCAGCTACGTAGGAGGCCAAGG - Intronic
1085421298 11:76363457-76363479 CCCAGCTACTCAGGAGTCCAAGG - Intronic
1087297223 11:96390500-96390522 CCCAGCCCGGGAGGGGATCAGGG + Exonic
1089938707 11:122393500-122393522 CCCAGCCAGTGAGGGGTTCATGG - Intergenic
1090207893 11:124895981-124896003 CTCAGCCAGGGAGGAACCCCAGG + Intronic
1090274467 11:125409905-125409927 TACAGCCAAGGAGGAGACCATGG + Intronic
1090519253 11:127460966-127460988 CCCGGCCAGGCAGCTGTCCATGG + Intergenic
1090882509 11:130846458-130846480 CCCAGACAGGGCGGAGCCAAGGG - Intergenic
1090958331 11:131533926-131533948 CCCACCCAGGGAGGGATCCAGGG + Intronic
1091034261 11:132218919-132218941 CCCAGCCAGTGAGTAGTGCAAGG - Intronic
1091281541 11:134384357-134384379 CCCTCCCAGAGAGGATTCCAGGG - Intronic
1091602236 12:1924984-1925006 CACAGCCCGGGAGGAGTGCAGGG + Intergenic
1091699343 12:2649973-2649995 CACAGGCAGGGAAGAGCCCAGGG + Intronic
1092070585 12:5628256-5628278 CCCAGGCAGGGAGGACAGCAGGG - Intronic
1094056460 12:26273938-26273960 GCCAGCAAGGGAGGAGTCGCGGG - Intronic
1095703876 12:45216983-45217005 CCCAGGCAGGGAGGACCGCAGGG + Intronic
1095840415 12:46685705-46685727 GCCCCCCAGGAAGGAGTCCATGG - Intergenic
1095962863 12:47846305-47846327 GCCAGGCAGGGAGGAGCTCAGGG - Intronic
1096669466 12:53190008-53190030 CCCACCCAGGCAGGAAACCAAGG - Exonic
1097186087 12:57197231-57197253 TCCAGACAGGCAGGAGACCAGGG + Intronic
1101259167 12:103011863-103011885 TCCAGGCAGGGAGGAGAGCAAGG + Intergenic
1102386546 12:112515104-112515126 CCCAGCGATGCAGGAGGCCAAGG - Intergenic
1102652147 12:114449550-114449572 CCCTGGCAGGGAGGACCCCATGG - Intergenic
1102903565 12:116657709-116657731 CCCCTCCTAGGAGGAGTCCAGGG - Intergenic
1102986564 12:117283310-117283332 CCCAGCAAGGTGGGAGGCCAAGG - Intronic
1103004181 12:117408502-117408524 CTCAGCCAGGTAGGAGGCCTGGG - Intronic
1103910627 12:124350120-124350142 CCCTGCCAGGAAGGAGTTAAGGG - Intronic
1104646938 12:130504327-130504349 CCCATCCTGGGAGGAGTCAGGGG - Intronic
1104787883 12:131461489-131461511 CCCAGCCAGGGGGCAGCCCCAGG + Intergenic
1104901055 12:132189746-132189768 CGCAGCGACGGAGGAGTCGAGGG + Intergenic
1105475794 13:20727324-20727346 CCGAGCCAGAGAGGAGGCCTGGG - Intergenic
1106402584 13:29444311-29444333 CCCAGCTAGTGAGGAGTCTGAGG + Intronic
1107309233 13:39059078-39059100 CCCAGCTACTGAGGAGGCCAAGG - Intergenic
1107444589 13:40458836-40458858 CACTCCCATGGAGGAGTCCATGG + Intergenic
1107773796 13:43815952-43815974 CCCAGCTACTGAGGAGTCTAAGG + Intergenic
1108263571 13:48681726-48681748 CCCAGCAAGGGAGGAGTCCAGGG + Intronic
1110278155 13:73662035-73662057 GCCAGTCAGGGAGGAGACCTTGG - Intergenic
1112281676 13:98068235-98068257 CCCAGGCAGGCTGGAGTACAGGG - Intergenic
1112375306 13:98834477-98834499 CCAAGACAGGGAGGAGCACATGG - Intronic
1113381589 13:109810691-109810713 CTCAGACAGGGAGGACTCGAGGG - Intergenic
1113596390 13:111537126-111537148 CCGAGGCAGGAAGGAGTTCAAGG - Intergenic
1113599006 13:111555051-111555073 GGCTGCCAGGGAGGACTCCACGG - Intergenic
1113803827 13:113101921-113101943 CCCAGGCAGGGATGTGTGCAGGG + Intergenic
1114712205 14:24790003-24790025 CATAGCCAGTGGGGAGTCCAGGG - Intergenic
1115976993 14:39007792-39007814 CACAGACAGGGAGGGGTTCAAGG - Intergenic
1117290457 14:54327031-54327053 CCCTGCCCCGGAGGAGCCCATGG - Intergenic
1120051733 14:79875011-79875033 CCCAGCCAGGGACTGGTTCACGG - Intergenic
1120881420 14:89417408-89417430 CTCAGCCAGGGCGGAGGCCGGGG + Intronic
1120981436 14:90292659-90292681 CCCAGGCAGGAAGCTGTCCAGGG - Intronic
1121098654 14:91234682-91234704 CACAGCCAGGTAGCGGTCCACGG + Exonic
1121107346 14:91289716-91289738 CAGTGCCAGGGAGGAGTCAAGGG - Intronic
1121675345 14:95747889-95747911 CAAAGCCAGGAAGGAGACCATGG + Intergenic
1121846143 14:97173768-97173790 CCCAGCCAGGGTGCACTGCAGGG + Intergenic
1122141644 14:99666546-99666568 CCCACTCTGGGAGGTGTCCAGGG - Intronic
1122396256 14:101434534-101434556 TCCATCCAGGTAGGGGTCCAGGG - Intergenic
1122415998 14:101549765-101549787 CCCAGCCACCGAGGACACCAGGG + Intergenic
1122542413 14:102505747-102505769 CCTGGGCATGGAGGAGTCCAGGG - Exonic
1122737046 14:103848719-103848741 CAGAGCAAGGGAGGAGGCCAGGG + Intergenic
1122885473 14:104708563-104708585 CCGGGCCAGGAAGGAGCCCAAGG + Exonic
1122978040 14:105179009-105179031 CCCAGCCAGGGCAGGCTCCAGGG + Intronic
1122979655 14:105185771-105185793 CTGAGCCATGGAGGAGCCCAGGG - Intergenic
1123804570 15:23858042-23858064 CACAGCCAGGGAGGCCTTCAAGG - Intergenic
1124187193 15:27541473-27541495 CACAGGCAGGAAGGATTCCATGG - Exonic
1124226955 15:27903030-27903052 CCCCGCAAGGAAGGAGGCCAAGG + Intronic
1125602577 15:40923598-40923620 TCCAGCCACGGAGCAGGCCAGGG - Intergenic
1127490058 15:59453956-59453978 CCCAGGCAGGCAGGAGTCAGAGG - Intronic
1127598607 15:60512400-60512422 CCCAGCTACGTAGGAGGCCAAGG - Intronic
1129166974 15:73784264-73784286 CCCAGCCATGGAGGAGTCTGAGG - Intergenic
1129412547 15:75358153-75358175 CCCAGCCAGGGAGGAGTCCAAGG + Intronic
1129451717 15:75654805-75654827 CACAGACAGGCAGGAGGCCAGGG - Intronic
1129574772 15:76731257-76731279 CTCAGCCAGGGAGGTGTTTAAGG + Intronic
1129637039 15:77331243-77331265 CCCAGCTATTGGGGAGTCCAAGG - Intronic
1129773585 15:78218378-78218400 CCCTGCCGTGGAGGAGCCCAGGG + Intronic
1129791017 15:78340599-78340621 CCCAGGCAGGAGGGAGTCCCCGG + Intronic
1130078733 15:80712422-80712444 CCCAGCCAAGGAGGGGTAGAAGG + Intronic
1130258090 15:82335052-82335074 CAGAGCCAGGGAGGTGCCCATGG - Intergenic
1130519107 15:84648705-84648727 CCTAGCCTGGCAGGAGGCCATGG + Intronic
1131890846 15:96969997-96970019 CCCAGGCAGGGAGAAGAGCAAGG + Intergenic
1132345381 15:101105074-101105096 CCCAGCCACTTAGGAGGCCAAGG - Intergenic
1132766486 16:1536971-1536993 CCCAGCCAGGGCTGACTCCCAGG - Intronic
1132815791 16:1826132-1826154 CGCAGACAGGGAGGCGTCCCTGG - Intronic
1132853682 16:2035602-2035624 CCCAGCCAGGGGGTGGGCCAGGG - Intronic
1133049027 16:3106360-3106382 CCCAGGCATGGAGGAGGCCTCGG + Intergenic
1133206107 16:4234680-4234702 CCCAGCTAGGGATGAGCACAGGG + Intronic
1135767131 16:25187453-25187475 CCTAGCCAGTGAGGAGAACAAGG - Intergenic
1135973619 16:27090226-27090248 CCCAGCCAGGGAGGTATCAGTGG + Intergenic
1136087122 16:27893302-27893324 CTCAGCAAGGGAGGGATCCAAGG - Intronic
1136172158 16:28495899-28495921 CCCAGGTAGGGAAGAGGCCAGGG + Exonic
1136776132 16:32872849-32872871 GCCAGCCAGGGAGGACTGCCAGG - Intergenic
1136894483 16:33988663-33988685 GCCAGCCAGGGAGGACTGCCAGG + Intergenic
1137670178 16:50274147-50274169 CGCAGCCACAGAGGAGGCCAGGG + Intronic
1137679082 16:50323441-50323463 CCCAGCCCGGCTGGAGGCCACGG - Intronic
1137874100 16:51979263-51979285 CCAAGACAGGGAAGAGTCCTGGG - Intergenic
1138168880 16:54830104-54830126 TCCAGCCATGCAGGAGCCCAGGG - Intergenic
1138607211 16:58097032-58097054 CCCACCCATGGAGGAGGACATGG - Intergenic
1139650964 16:68361833-68361855 CCCACACTGGGAGGAGACCATGG - Intronic
1139654699 16:68380307-68380329 CCAAGACAGAGAGGAGGCCAGGG + Intronic
1139952501 16:70679120-70679142 CCTGGCCAGGGATGAGTCCCGGG - Intronic
1139994668 16:70968490-70968512 CCCAGCCAGGAAGGTATCAATGG + Intronic
1140248491 16:73272860-73272882 CCCAGCTATGTAGGAGGCCAAGG - Intergenic
1140410558 16:74738275-74738297 GCCAGGCAGGGAGCAGTCCATGG + Intronic
1141067124 16:80923077-80923099 CCCAGCCATGGAGGAGCGCTGGG + Intergenic
1141963254 16:87423657-87423679 CCCAGCCACAGTGGAGTCCCAGG - Intronic
1142125773 16:88409557-88409579 GCCAGCCGGGGAGGGGTCCTGGG + Intergenic
1142132132 16:88435946-88435968 GACACCCAGGGTGGAGTCCAGGG + Exonic
1142349323 16:89572705-89572727 GACGGCCAGGGAGGAGGCCATGG + Intergenic
1203078548 16_KI270728v1_random:1134958-1134980 GCCAGCCAGGGAGGACTGCCAGG - Intergenic
1142614084 17:1125008-1125030 CCGAGCCTGAGAGGGGTCCAGGG + Intronic
1143092822 17:4459105-4459127 AGCAACCAGGGAGGAATCCATGG - Intronic
1144649037 17:16995917-16995939 CCCAGCCAGAGAGGAGGCCTTGG - Intergenic
1144955822 17:19018305-19018327 CTCAGCCAGGGAGGAGCGGATGG + Intronic
1145268136 17:21390266-21390288 CCCAACCAGGGTGTAGTGCAGGG - Intronic
1145881693 17:28357208-28357230 CCTAGCCAGTGCGGAGGCCAGGG - Intronic
1145908268 17:28528141-28528163 CCAAGCCAGGGAGGAAGGCAAGG + Intronic
1145960252 17:28883040-28883062 CCAAGGCAGGGAGGTGTGCAGGG - Intronic
1147298527 17:39504761-39504783 CCCAGCCACGTGGGAGGCCAAGG + Intronic
1147327231 17:39675262-39675284 CCGAGCCTGGGAGGAGTAGAGGG + Intronic
1147635547 17:41961779-41961801 CCCTGCCCTGGAGGAGCCCATGG + Intronic
1147667897 17:42160198-42160220 CCCAGCCAGTGTGGGGACCATGG - Exonic
1148846500 17:50532997-50533019 CACTGCCAGGGAGGGGGCCAGGG - Intronic
1149082993 17:52680267-52680289 CCCAGCCACTCAGGAGGCCAAGG + Intergenic
1149158105 17:53658166-53658188 CCCAGCTAGTGTGGAGGCCAAGG - Intergenic
1149536218 17:57435689-57435711 CCCAGCCAGGGAGGGCCTCAGGG + Intronic
1149537158 17:57441961-57441983 CCAAGCAAGGGAGGTCTCCAGGG - Intronic
1150314648 17:64158361-64158383 CCCTGCCAGGCAGGACACCAGGG + Intronic
1151349220 17:73521811-73521833 CCCAGCAAGGGAGGTGTCACAGG - Intronic
1152073675 17:78146313-78146335 CCCACCCAGGGAGCATCCCAGGG + Intergenic
1152489644 17:80621611-80621633 CCCTCCCAGCGAGGAATCCAGGG - Intronic
1152647412 17:81475863-81475885 CTCAGCCAGGGAGGTGAGCAGGG + Intergenic
1152821484 17:82439871-82439893 CCCAGCCTGGGTGGACTTCAGGG - Intronic
1153406573 18:4747578-4747600 CCCACCCTGGGAGGGGTCCGTGG + Intergenic
1153535814 18:6100705-6100727 CTCAGCCAGGGTGGCATCCAGGG - Intronic
1153984996 18:10343812-10343834 TCCAGCCAGGAATGAGGCCAAGG - Intergenic
1155369206 18:25080104-25080126 CCCAGACATGGAGGGGCCCAAGG + Intronic
1157493984 18:48142443-48142465 CCCTGCCAGGCTGGAGTGCAGGG + Intronic
1158511502 18:58094669-58094691 CACAGCAGGGGTGGAGTCCATGG - Intronic
1159037257 18:63289641-63289663 CCCAGCCCTCGAGGAGGCCAAGG + Intronic
1160259698 18:77280734-77280756 CCCAGCCAAGGAAGAGTGCAAGG - Intergenic
1160566133 18:79787915-79787937 CCCAGCCAGGGAGGAGACGCCGG + Intergenic
1160580151 18:79879118-79879140 CCTAGGCAGGGAGGGGTCTATGG - Intronic
1160919826 19:1514085-1514107 CCGAGCCTGGGTGGAGCCCAGGG - Intergenic
1160946768 19:1647399-1647421 CCCAGCCAGCCAGGAGGCGAAGG + Intronic
1161391949 19:4025631-4025653 CCCAGGCAGAGAGGCCTCCATGG - Intronic
1161484768 19:4529343-4529365 CGGAGCCAGGTAGAAGTCCAGGG - Exonic
1161638838 19:5406911-5406933 CTCATCACGGGAGGAGTCCAGGG - Intergenic
1161928461 19:7319234-7319256 CCCAGCTAGTCAGGAGGCCAAGG - Intergenic
1162335339 19:10056753-10056775 CCCAGCCACTGAGGAGGCTAAGG - Intergenic
1162981904 19:14245898-14245920 CCCAGCCACTCAGGAGCCCAAGG - Intergenic
1163022133 19:14487929-14487951 CCCAGCTCGTTAGGAGTCCATGG - Intronic
1163222457 19:15931308-15931330 GCCAGGCAGGGAGTAGTCCCTGG + Intronic
1163312813 19:16524132-16524154 CCCAGCTACTGAGGAGGCCAAGG + Intronic
1163561048 19:18019764-18019786 CCCAGCTAGTCAGGAGGCCAAGG - Intergenic
1164908264 19:31985203-31985225 CCCAGCCAGGGCTGAGCACAGGG + Intergenic
1165069964 19:33249390-33249412 GCCAGCCAGGCAGGGGTCCTGGG - Intergenic
1165245846 19:34498011-34498033 CCAGGCCAGGGAGGAGTGCGGGG - Intronic
1165640136 19:37377773-37377795 CCCACCCAGGGAGGGAGCCAGGG + Intronic
1165880620 19:39040231-39040253 CCCAGCCACTCAGGAGGCCAAGG - Intergenic
1166422749 19:42651528-42651550 CCCAGGCAGGGAGGAGAGAAGGG + Intronic
1166878736 19:45914149-45914171 TCCAGCCAGGGTGGAGTTCTGGG + Exonic
1166942270 19:46374155-46374177 CCCAGACAGGGAGGAGGCCGTGG + Intronic
1166996158 19:46720563-46720585 CCCAGCCAGCGTGGCGGCCAGGG + Exonic
1167220749 19:48196661-48196683 CCCATCCAGGAAGAAGTCCGAGG - Intronic
1167382783 19:49148465-49148487 GCCAGCCTGGAAGGGGTCCAGGG - Intronic
1167664996 19:50818662-50818684 CCCAGCCAGGGTGGTCTGCATGG + Intergenic
1167885005 19:52493180-52493202 CCGAGCCTGGGAGGCGCCCAGGG - Intronic
1168205172 19:54845179-54845201 CCCAGCCCTGCAGGAGGCCAAGG + Intronic
1168236564 19:55067398-55067420 CTCAGCCAGGGAGGAGACTCCGG + Intronic
1168544687 19:57240670-57240692 CGCCGCCAGGGAGGCGGCCACGG - Intronic
1168578933 19:57537103-57537125 CACAGGGAGGGACGAGTCCATGG - Intronic
925976906 2:9148106-9148128 CCAAGCCAGGGTGGGGGCCAGGG + Intergenic
926088612 2:10035878-10035900 CTGAGCCAGGAAGGTGTCCAGGG + Intergenic
926748693 2:16181285-16181307 CTCAGACAGGCTGGAGTCCAAGG - Intergenic
927082483 2:19644168-19644190 CACAGCTAGGCTGGAGTCCAAGG - Intergenic
929536830 2:42789029-42789051 TCCAGCCAGGGGAGAGTGCAGGG - Intronic
929598938 2:43193031-43193053 CCCAGGCAGCGATGTGTCCAGGG + Intergenic
929908844 2:46071528-46071550 CCCAGGCAGTCAGGATTCCAAGG + Intronic
929918285 2:46154270-46154292 CCAAGCCAGTGAGGAGGCCTCGG + Intronic
930836630 2:55800999-55801021 GGCATCCAGGGAGGAGGCCAGGG + Intergenic
931405561 2:61974176-61974198 CCCAGCTACTCAGGAGTCCAAGG + Intronic
932127682 2:69158895-69158917 CCTCGCCATGGAGGAGTTCATGG - Intronic
932494593 2:72140150-72140172 CCAAGGCAGGGAGGGGTCCAAGG - Intronic
932510512 2:72283551-72283573 CCCAGCCATGGAGGAGTAGGGGG + Intronic
933084397 2:78037621-78037643 CCCAGCCACTCAGGAGGCCAAGG + Intergenic
933714553 2:85350530-85350552 CCTAGTCAGGGAGGAGAGCAGGG + Intronic
933975634 2:87507061-87507083 CCCAGCTAAAGAGAAGTCCAAGG - Intergenic
934723771 2:96601876-96601898 CCCAGCTGGGGAGGAGGCCAAGG - Intronic
936096461 2:109533972-109533994 GCCAGACCGGGAGGAGCCCAGGG + Intergenic
936293421 2:111246787-111246809 CCCAGGGAGGGAGAAGACCAAGG - Intergenic
936318190 2:111443752-111443774 CCCAGCTAAAGAGAAGTCCAAGG + Intergenic
936861738 2:117027791-117027813 CCCAGCCAGGGAGGTATCAGGGG + Intergenic
936966146 2:118129397-118129419 ACCAGGCAGGAGGGAGTCCAGGG - Intergenic
937079439 2:119129745-119129767 CCCCGCCAGGAAGGTGTGCACGG + Intergenic
937235905 2:120431873-120431895 CCCCGACATGAAGGAGTCCAGGG - Intergenic
937439762 2:121905828-121905850 TCCAGCCTCGGAGGAGTCCCCGG - Intergenic
937914848 2:127093891-127093913 CCCAGCACTGGAGGAGTCCAGGG - Intronic
938045906 2:128120025-128120047 CCCAGCCACTGAGGAGGCCAAGG - Intronic
938066249 2:128283498-128283520 AGCAGCCAGGGAGGTGTCCATGG + Intronic
939615839 2:144361564-144361586 CCCAGCTACTGAGGAGGCCAAGG - Intergenic
940112616 2:150171173-150171195 CTCGGCCAGGCAGGAGCCCATGG + Intergenic
940768084 2:157811107-157811129 CCCAGCTAGGGAGGAAGCCAAGG - Intronic
941420776 2:165280969-165280991 CCCAGCCAGTTGGGAGGCCAAGG + Intronic
944576416 2:201095240-201095262 CCCAGCAAGTCAGGAGGCCAAGG + Intergenic
946236823 2:218329466-218329488 CCCAGCCAGGGCTGAGACCATGG + Intronic
946689496 2:222299656-222299678 CTCCTCCTGGGAGGAGTCCAGGG + Intronic
946921229 2:224584571-224584593 CCCACACAGGGAGGACTCCGCGG + Intronic
947913787 2:233819173-233819195 CTCAGCCCAGGAGGAGGCCATGG + Intronic
947965773 2:234280334-234280356 ACCTGGCAGGAAGGAGTCCATGG + Intergenic
947972747 2:234337595-234337617 CCTAGCAAGGGAGGCGGCCAGGG + Intergenic
948051516 2:234982657-234982679 CACAGGCAGGGAGGGGACCAAGG + Intronic
948182432 2:235992905-235992927 CCCAGGTAGGGAGGAGGTCAAGG - Intronic
948609421 2:239157336-239157358 CCCAGAGAGGGAGGTGACCAGGG - Intronic
948780061 2:240314240-240314262 CCCAGCCACTCAGGAGGCCAAGG + Intergenic
948838481 2:240637468-240637490 CCAAGAGATGGAGGAGTCCATGG + Intergenic
948979355 2:241485233-241485255 CCCAGGGAGGGAGGACTACAGGG - Intronic
948979479 2:241485629-241485651 CTCAGGGAGGGAGGACTCCAGGG - Intronic
1168835493 20:874544-874566 CCCAGCCTGGGTGGAGTGCTTGG + Intronic
1168862001 20:1052177-1052199 ACCAGCCAGACAGGACTCCAAGG - Intergenic
1169083999 20:2815838-2815860 CCCAGCCAGGAAGGAGAAAAGGG - Intergenic
1169141685 20:3230353-3230375 CCCTGCCAGGAAGAAGGCCAGGG + Intronic
1169253863 20:4082920-4082942 CCCAGCCAGGGTGTTGTCGATGG - Intergenic
1170599725 20:17831957-17831979 CCCAGCCAGGAAGCTGACCAGGG + Intergenic
1171034824 20:21706293-21706315 CCCAGACAGCTCGGAGTCCAAGG - Intronic
1171250201 20:23640619-23640641 CCCAGCCATGGCGGAGCCCCAGG - Intergenic
1171279154 20:23881776-23881798 CCCAGCCATGGCGGAGCCCCAGG - Intergenic
1171983713 20:31644925-31644947 CCCAGCCAGGGCGGAGCCTCAGG - Exonic
1172101492 20:32486342-32486364 CCCAGCCTGGTAGGAGACCATGG + Intronic
1172175327 20:32968746-32968768 CACAGACAGGGAGGGTTCCAGGG - Intergenic
1172177333 20:32980353-32980375 GCCAGCCAGGGTGGGATCCAAGG - Intergenic
1172710676 20:36920719-36920741 CCCACCCAGGCTGGAGTGCAGGG - Intronic
1173059843 20:39650848-39650870 GCCAGCCACAGAGGACTCCAGGG - Intergenic
1174870335 20:54175095-54175117 ACCAGCCAGGGAGGAGGGGAGGG + Intergenic
1174920043 20:54692162-54692184 CCCTGCCAGGGAGGGGTTGAGGG - Intergenic
1175257672 20:57656915-57656937 CCCTGCCAGACAGGAGTCCCTGG - Intronic
1175936876 20:62518041-62518063 CCCAGCCAGTGAGGTCTCCTTGG + Intergenic
1176084536 20:63290001-63290023 CCCAGCCAGGGAAGAGTTTACGG + Intergenic
1178375592 21:32065045-32065067 GCCAGCCAGGGTGGTGGCCAAGG - Intergenic
1179152070 21:38817734-38817756 GCCAGCGAGGGAGGGGTCCTCGG + Intronic
1179323193 21:40312999-40313021 CCCAGCTACTGAGGAGGCCAAGG + Intronic
1179823103 21:43948389-43948411 TCCAGCCAGGGAGAAGTCTGCGG - Intronic
1179830978 21:43995715-43995737 CCAAGCCAGGGACCAGACCAAGG + Intergenic
1179887244 21:44319435-44319457 CCCAGCCATGTAAGAGTGCAGGG - Intronic
1180050879 21:45330556-45330578 CCCAGCCAGGCCGGGGACCAGGG + Intergenic
1180168511 21:46043516-46043538 CCCAGCTAGTCAGGAGGCCAGGG + Intergenic
1180615326 22:17122286-17122308 CCCAGCCTTGGATGAGTCCTGGG - Intronic
1180787893 22:18557193-18557215 CCCAGCCAGGAGGGAGGCCTGGG + Intergenic
1180878990 22:19190481-19190503 CCCAGCACTGGAGGAGGCCAAGG + Intronic
1181084319 22:20432299-20432321 AGCAGCCAGGGAGAAGACCATGG + Intronic
1181233845 22:21438125-21438147 CCCAGCCAGGAGGGAGGCCTGGG - Intronic
1181244805 22:21496718-21496740 CCCAGCCAGGAGGGAGGCCTGGG + Intergenic
1181418185 22:22775380-22775402 CCCAGCTACTGAGGAGTCTAAGG - Intronic
1181959555 22:26613030-26613052 CCCTGCCCTGGAGGAGTCCTTGG - Intronic
1182378542 22:29867362-29867384 CCCAGCTACTTAGGAGTCCAAGG + Intergenic
1182483378 22:30624656-30624678 CCCAGCCAGGAAGCAGACCTGGG + Intronic
1182489633 22:30662711-30662733 CCCAGCCACGCAGGAGGCTAAGG + Exonic
1183670498 22:39269822-39269844 CCCAGGGAGGGAGGAAGCCATGG + Intergenic
1183732943 22:39628605-39628627 CCCAGCCAGGGAGGGGCCTGTGG - Intronic
1183965522 22:41439629-41439651 CCCAGCCATTCAGGAGGCCAAGG - Intronic
1184032050 22:41900900-41900922 GCCAGCCAAGGAGGTGCCCAGGG - Intronic
1184498770 22:44859651-44859673 CCCGGCCCGGGAGGAGAACAGGG - Intronic
1185257570 22:49844331-49844353 CCCAGCCATTTAGGAGGCCAAGG + Intergenic
949313714 3:2728740-2728762 ACCAGCCAGGGAAGACTGCATGG - Intronic
950186329 3:10947900-10947922 CCCAGGCAGCTAGGAGGCCAGGG + Intergenic
950501095 3:13364405-13364427 CCCAGCCAGGGCAGAAGCCAAGG - Intronic
953972095 3:47355751-47355773 CCCAGGCTGGGAGGAGGGCATGG + Intergenic
954138711 3:48594291-48594313 CCCAGAGAGGGAGGAGACCCTGG - Intronic
954625445 3:52019751-52019773 CCCAGCATGGGAGGCCTCCAGGG + Intergenic
954841302 3:53514333-53514355 CAGAGCCAGAGAGGAGACCATGG + Intronic
955410660 3:58653495-58653517 ACCAGGAAGGGTGGAGTCCATGG - Intronic
956739009 3:72260369-72260391 GCCAGCCAGGGAGGTGTCCTTGG + Intergenic
958041682 3:88233850-88233872 CCCAGCCACTCAGGAGGCCAAGG - Intergenic
959854128 3:111128219-111128241 CCCAGCCACTCAGGAGTCTAAGG + Intronic
959966343 3:112359957-112359979 TCCAGCCATGGAGGAGACAAGGG + Intronic
961196034 3:125002140-125002162 CCCAGCCATGGGGCAATCCAGGG - Intronic
961824601 3:129592494-129592516 TCCAGCCAGGGTGGGGTCCTGGG + Intronic
961854140 3:129852339-129852361 CCCAGCTACTCAGGAGTCCAAGG + Intronic
962129822 3:132660531-132660553 CCCAGCCATGGCGGAGTCTGTGG + Exonic
962258200 3:133886413-133886435 CTCAGCCAGGGTGGAGTATAAGG - Intronic
962284626 3:134075642-134075664 CCAGACCAGGGAGGAGGCCATGG - Intronic
963603022 3:147393426-147393448 CCCACCCAGGGCGCAGTGCAGGG - Intronic
965757483 3:172040485-172040507 CCCAGCCCGGGGGGAGCCCGGGG - Intronic
966892951 3:184420821-184420843 CCCAGCCACTCAGGAGGCCAAGG - Intronic
966931374 3:184677944-184677966 TCCCTCCAGGGAGGAGGCCAAGG + Intronic
967191648 3:186990147-186990169 CCCAGCCACTGGGGAGGCCAAGG - Intronic
967443051 3:189531215-189531237 CCAAGCAAGGCAGGGGTCCATGG + Intergenic
967640012 3:191851187-191851209 CCCAGCTACGGGGGAGTCCGAGG + Intergenic
967804873 3:193707026-193707048 CCCACCCAGGCTGGAGTGCAGGG + Intergenic
967890194 3:194359373-194359395 GGCAGCCAGGGAGCAGGCCAGGG + Exonic
968045384 3:195621039-195621061 GGCAGGCAGGGAGGAGTCCTGGG + Intergenic
969056674 4:4406864-4406886 CCCAGCCAGGGAGGGCTGCCTGG - Intronic
969254926 4:5995156-5995178 CCCACCCAGGGAGGAGGCCCTGG - Intergenic
969366012 4:6694624-6694646 CCCTGCCAGGGAGGAGCCACCGG + Intronic
969626167 4:8306755-8306777 CCCAGGCAGGCAGGAGGCCGCGG + Exonic
969709437 4:8834352-8834374 CCCAGCCACGGCGGACCCCAAGG - Intergenic
971212931 4:24637229-24637251 CACAGCCAGGTACGGGTCCACGG - Intergenic
971376748 4:26061832-26061854 TGAGGCCAGGGAGGAGTCCAGGG + Intergenic
972228620 4:37043969-37043991 CCCAGCAAGGATGGAGGCCAAGG + Intergenic
975234156 4:71971617-71971639 CCCAGCTAGTGAGGAGGCTAGGG + Intergenic
975521548 4:75307133-75307155 CTCACCCATGGAGTAGTCCAAGG - Intergenic
975611858 4:76211830-76211852 CCCAGCTAAGGAGGACTGCACGG - Intronic
977200884 4:94114323-94114345 CCGAGTCATGGAGGAGTTCAAGG - Intergenic
977277245 4:94992919-94992941 GCCATCCAGGCTGGAGTCCAGGG + Intronic
978914673 4:114109675-114109697 GTCACCCAGGGTGGAGTCCAGGG + Intergenic
980501909 4:133666910-133666932 CCCAACATTGGAGGAGTCCAAGG - Intergenic
980897579 4:138874808-138874830 ACCAGCCAGTGAGGAGTCTCTGG + Intergenic
981429320 4:144641926-144641948 CCCAGCAACTGGGGAGTCCAAGG - Intergenic
983699915 4:170579324-170579346 CCCAGCCAGGGAGGTCTCAGTGG + Intergenic
984734481 4:183098040-183098062 CCCGGCTGGAGAGGAGTCCAGGG + Intergenic
984766585 4:183404757-183404779 CCCAGGCAGGAAGGAGTTCAAGG + Intergenic
984917045 4:184734173-184734195 CCAGGCCAGGGAGGAGCCCGGGG - Intergenic
985039773 4:185878640-185878662 CCCAGTCAGGAAGGAATCCCGGG - Intronic
985924063 5:3001962-3001984 CCAAGCCAGGCAGGAGCCCAGGG + Intergenic
986342802 5:6805583-6805605 TCCAGCCAGGGGGAAGCCCATGG + Intergenic
986588514 5:9344603-9344625 CCCAGGCAGCAAGAAGTCCAGGG + Intronic
987086792 5:14477666-14477688 CACAGCAAGGGAGAAGTTCATGG - Intronic
987252782 5:16117636-16117658 CCCAGCTACGCAGGAGGCCAAGG + Intronic
987710207 5:21495121-21495143 CACAGGCTGGGAGGGGTCCAAGG - Intergenic
988749406 5:34179052-34179074 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
988933010 5:36055270-36055292 CCCACCCAGGCTGGAGTGCATGG + Intronic
989169996 5:38464478-38464500 ACCAGCCAGTGAGGAGTGGAAGG - Exonic
989242307 5:39215544-39215566 CCCAGCCAGCCAGGGGTGCAAGG + Intronic
990335185 5:54765388-54765410 ACCATCCAGGGAGGTGCCCAGGG + Intergenic
990505387 5:56439098-56439120 CCCAGCCACTCAGGAGGCCAAGG - Intergenic
991501944 5:67285883-67285905 CTGGGCCAGGGAGCAGTCCATGG + Intergenic
991737661 5:69642244-69642266 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991760533 5:69914181-69914203 CACAGGCTGGGAGGGGTCCAAGG - Intergenic
991786799 5:70203920-70203942 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991789237 5:70221970-70221992 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991813988 5:70497076-70497098 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991817121 5:70518360-70518382 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991839764 5:70789231-70789253 CACAGGCTGGGAGGGGTCCAAGG - Intergenic
991879247 5:71204305-71204327 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991881687 5:71222334-71222356 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
991934033 5:71784184-71784206 GCCAGCCAGTGAGGAGTTAAGGG - Intergenic
991939798 5:71839602-71839624 GCCTGCCAGGGAAGAGGCCATGG - Intergenic
992483659 5:77175331-77175353 CCAGGCCAGGGAGGAGGCCTTGG - Intergenic
992549366 5:77846601-77846623 CCCAGCCAGGGAGGCCTGGACGG + Intronic
992690512 5:79236580-79236602 CGCAGCCAGCGGGGAGTCCTCGG + Exonic
992894291 5:81233278-81233300 CCCCGCCAGGGAGGATTTCCAGG + Intronic
993733280 5:91447191-91447213 TGCAGCCAGGGAGGATTTCAAGG - Intergenic
994460211 5:100062314-100062336 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
994484359 5:100375739-100375761 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
997439033 5:133896324-133896346 CTCAGCCAGGGATGAGCTCAGGG + Intergenic
997638872 5:135435509-135435531 CCAAGCCAGAGAGGGGCCCATGG - Intergenic
998817887 5:146032007-146032029 CCCAGCCAGGTAGGAGGGCATGG + Intronic
998879941 5:146635586-146635608 CCAACCCAGGGTGGAGGCCAGGG - Intronic
999328783 5:150659258-150659280 CCCAAGCATGGAGCAGTCCATGG + Intergenic
1000306190 5:159996688-159996710 CCCAGCCACTCAGGAGACCAAGG + Intergenic
1000645355 5:163754838-163754860 CCCATCCTGGGAGGAGTTAAAGG - Intergenic
1000768094 5:165317065-165317087 CCCTGCCAGGATGGAGCCCATGG + Intergenic
1000907333 5:166978774-166978796 CGCAGCCAGGGAGGGGCTCACGG - Intergenic
1001299458 5:170523511-170523533 CCCAGCCAGGTAGGAGTCTTAGG - Intronic
1001683878 5:173578030-173578052 CCCCGCCAGGGTGGAGCCCATGG + Intergenic
1002421242 5:179150183-179150205 CCCAGGCAGGGAGGAGGCAGAGG - Intronic
1002690008 5:181044115-181044137 CCCAGACAGGCAGGAATACAAGG - Intronic
1005042552 6:21612209-21612231 CCAAGCCACGCAGGAGTCCAGGG - Intergenic
1005276752 6:24227672-24227694 CCCAGCCAGTTAGCAGTTCAGGG - Intronic
1005547480 6:26885398-26885420 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
1005561371 6:27045166-27045188 CCCAGCCAGGGTGGGCGCCAAGG - Intergenic
1005732574 6:28712614-28712636 CCCAGCTAGTCAGGAGTCCAAGG + Intergenic
1006271598 6:32970298-32970320 CCCAGCCAGGGATCAGGCCCTGG - Intronic
1006510603 6:34519196-34519218 CCCAGCTAGGAAGGGGCCCAAGG - Intronic
1006986402 6:38178551-38178573 CCCAGCCAGGCAGGCGGTCAGGG + Intronic
1007234106 6:40378225-40378247 CCCACCCAGGGAGAAGCCCTGGG - Intergenic
1008098518 6:47365972-47365994 CCCAGCTACGGAGGAGGCTAAGG + Intergenic
1008884265 6:56414814-56414836 CACAGGAAGGAAGGAGTCCAGGG + Intergenic
1009018241 6:57926465-57926487 CACAGGCTGGGAGGGGTCCAAGG + Intergenic
1009334890 6:62474747-62474769 CCCAGCCACTGAGGAGGCTAAGG + Intergenic
1010335968 6:74683777-74683799 CCCAGCCAGGTAGGCATCCGTGG + Intergenic
1010604558 6:77872327-77872349 CCCAGCTACTCAGGAGTCCAGGG + Intronic
1011668813 6:89662492-89662514 CCCAGCTTGGGAGAACTCCAGGG - Intronic
1012879624 6:104770601-104770623 CCCAGCTACTGAGGAGGCCAAGG + Intronic
1013171574 6:107640948-107640970 GCCATCCAGGGACGAGTCCAGGG - Intronic
1013291193 6:108719990-108720012 CACAGCCAGGGAGGAGTTAATGG + Intergenic
1016468467 6:144349434-144349456 CCCAACCAGGGAGGATGCCCCGG + Intronic
1017894191 6:158665255-158665277 CACAGCCATGTTGGAGTCCAGGG + Intronic
1018368977 6:163149915-163149937 CCCAGGGCGGGAGGAGTCCCAGG - Intronic
1018758781 6:166872388-166872410 CCCAGCCTGGGAGAAGGGCATGG + Intronic
1019411893 7:910286-910308 CCCACCCAGGCTGGAGTGCAGGG + Intronic
1019504793 7:1385475-1385497 CTCTGACAGGGAGGAGGCCACGG + Intergenic
1019572671 7:1720225-1720247 CCCAGGCTGGATGGAGTCCACGG + Intronic
1022142950 7:27509097-27509119 CTCAGCAGGGGAGGAGGCCAAGG - Intergenic
1023822048 7:43985996-43986018 CCCAGTCGGGGAGGCGCCCAAGG - Intergenic
1025927316 7:65970321-65970343 CACAGGCCGGGAGGGGTCCAAGG + Exonic
1025989837 7:66489135-66489157 CCCAGCTACGCAGGAGGCCAAGG - Intergenic
1026248531 7:68645690-68645712 CCCAGCTAGTCAGGAGGCCAAGG + Intergenic
1026835557 7:73636675-73636697 CCCAGCCTGGCAGTTGTCCATGG - Intergenic
1026949441 7:74337709-74337731 CCCAGCTAGTGAGGAGGCTAAGG - Intronic
1026969151 7:74457519-74457541 CCCACCCTGGTAGGAGTCCCAGG + Intronic
1027268380 7:76506133-76506155 GCCAGGCATGGAGGAGCCCACGG + Intergenic
1027350819 7:77309304-77309326 GCCAGCCTGGGAGCAGCCCATGG + Intronic
1027392004 7:77713751-77713773 CCAACACAGGGAGGAGGCCAAGG - Intronic
1029531276 7:101126962-101126984 CCCAGAGAGGGAGGTGTCGAGGG + Intergenic
1029644954 7:101848574-101848596 CCCAGCCTGGTAGGCCTCCATGG + Intronic
1029705174 7:102272306-102272328 CGCAGTCAGGGATGAGTCCACGG + Intronic
1029750311 7:102539410-102539432 CCCAGTCGGGGAGGCGCCCAAGG - Intronic
1029768263 7:102638518-102638540 CCCAGTCGGGGAGGCGCCCAAGG - Intronic
1032122707 7:129168635-129168657 GCCAGACAGGGAGGAATTCAAGG - Exonic
1033275607 7:139969620-139969642 CTCACCCAGGGAGGAGGGCATGG + Intronic
1034692163 7:153022584-153022606 CCCCGCCAGGGAGTAATACATGG - Intergenic
1036790310 8:11713420-11713442 CCCAGGCAGGGCAGAGTCCTGGG - Intronic
1037482415 8:19316537-19316559 CCCAGCCAGGAAGGACAGCAAGG - Intronic
1037818903 8:22126209-22126231 CCCAGCCAGGGCAGAGGCCTGGG + Intronic
1038348541 8:26755331-26755353 GTCAGTCAGGGATGAGTCCAAGG - Intronic
1039493743 8:37966053-37966075 CACAGCCAGGTAGCGGTCCACGG + Exonic
1041096157 8:54352067-54352089 CCCATCCAGGGAGAAGTGCGGGG - Intergenic
1044853605 8:96452570-96452592 TCCAGCCAGGCAGGAGCCCATGG - Intergenic
1046521354 8:115330637-115330659 TCCAGCCAAGCGGGAGTCCACGG + Intergenic
1047935028 8:129767809-129767831 CCCAGTCAGGGAGCACTTCATGG + Intronic
1049006286 8:139857670-139857692 CCCAGGCAGGGAGGAGGCAGAGG - Intronic
1049243270 8:141549322-141549344 CCCAGCCAAGCAGTAGGCCAGGG - Intergenic
1049326882 8:142026186-142026208 CCCAGAGAGGGAGAAGTTCAAGG + Intergenic
1050223726 9:3426458-3426480 CCCACCCAGGTACCAGTCCATGG + Intronic
1050592720 9:7176483-7176505 CCTAGCCAGGGAGCAGTCTAGGG - Intergenic
1054352589 9:64030774-64030796 CCCAGCACTGCAGGAGTCCAGGG - Intergenic
1055950677 9:81726797-81726819 CCCAGCTACTCAGGAGTCCAAGG + Intergenic
1056765908 9:89444225-89444247 GGCAGCCAGGGAGGAGGCCATGG - Intronic
1057436382 9:95044745-95044767 CCCAGCCAGAGAGAAGTGCAGGG + Intronic
1057996740 9:99825851-99825873 CTCAGCCAGGGAGGAGAAAAGGG - Intronic
1058402573 9:104635127-104635149 CACAGACAGGGATGAGTCCCTGG - Intergenic
1058485986 9:105443956-105443978 CCCAGCCTGGGAAGACTCCAAGG - Intergenic
1060175050 9:121491519-121491541 CCTGGCCAGGGAGGTGGCCAGGG - Intergenic
1060466676 9:123912913-123912935 CCCAGCCATGGAGGTTTCCATGG + Intronic
1060791734 9:126489834-126489856 CTCAGCCAGGGAGGTGACCAGGG + Intronic
1061170596 9:128950727-128950749 CCCAGCTACTTAGGAGTCCAAGG + Intronic
1061858888 9:133457822-133457844 CACAGCCAGGGAGCCGTGCAGGG - Intronic
1062000040 9:134211360-134211382 CCCAGCAAGGGAGGCCTCCGTGG - Intergenic
1062280629 9:135750204-135750226 CCCAGGCAGGGAGGTGTTGAGGG + Intronic
1062284554 9:135767302-135767324 GCCAGGCAGGGATGAGCCCAGGG + Intronic
1062292544 9:135803293-135803315 CCCAGCTGGGGTGGAGTCGACGG - Intergenic
1062294392 9:135816382-135816404 CCCAGCCAGGGATGAGACCTAGG + Intronic
1062309131 9:135926534-135926556 CCCAGCCAGGGTGCATCCCAGGG - Intergenic
1062386051 9:136311937-136311959 GCCAGCCAGGGTGGGGTCCTTGG - Intergenic
1062466178 9:136682603-136682625 CCCAGCAAGGCAGGAGGCCCAGG + Intronic
1062611046 9:137373546-137373568 CCCGGCCAGGGGGTCGTCCAAGG + Exonic
1185505651 X:630891-630913 CCCAGCCATGGAAGAGCTCACGG + Exonic
1187269358 X:17765716-17765738 GCCAGGCAGGGAGCAGTACATGG - Intergenic
1190248828 X:48707405-48707427 CACAGCCAGGGAGGAGAGGAGGG - Intronic
1192320784 X:70088984-70089006 CCCTGCATGGGAGGATTCCAAGG - Intergenic
1192442174 X:71182658-71182680 CCCACTGAGGGAGGAGTCCGGGG + Intergenic
1197120876 X:122890785-122890807 GCCAGCCACTGAGGAGGCCAAGG + Intergenic
1197702123 X:129607436-129607458 CCCAGCAAGTGAGCAGTACAAGG + Intergenic
1197844649 X:130788461-130788483 CCCAGCAAGGAATGAGTCCCAGG - Intronic
1198394005 X:136205279-136205301 CACAGCCGGGGAGGGGACCAGGG + Intronic
1198895041 X:141444507-141444529 CCCAGCTACTGAGGAGGCCAAGG - Intergenic
1199605909 X:149579573-149579595 CCCCTCCTGGGAGGAGCCCAGGG + Intergenic
1199633212 X:149789795-149789817 CCCCTCCTGGGAGGAGCCCAGGG - Intergenic
1200091364 X:153637625-153637647 CCCCACCAGGGTGGAGTTCAAGG - Intergenic
1200103746 X:153701194-153701216 GCCAGCCAGGGAGGACTGCCAGG + Intronic
1200753981 Y:6972813-6972835 CCCTCACAGGGAAGAGTCCAGGG - Intronic