ID: 1129414591

View in Genome Browser
Species Human (GRCh38)
Location 15:75368265-75368287
Sequence CGGTGGGGCCGCACTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129414580_1129414591 4 Left 1129414580 15:75368238-75368260 CCCGTTTCCGCCTGGGGGCCAGC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414581_1129414591 3 Left 1129414581 15:75368239-75368261 CCGTTTCCGCCTGGGGGCCAGCT 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414579_1129414591 5 Left 1129414579 15:75368237-75368259 CCCCGTTTCCGCCTGGGGGCCAG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414583_1129414591 -3 Left 1129414583 15:75368245-75368267 CCGCCTGGGGGCCAGCTGGCCGG 0: 1
1: 0
2: 2
3: 41
4: 229
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414578_1129414591 8 Left 1129414578 15:75368234-75368256 CCGCCCCGTTTCCGCCTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414573_1129414591 29 Left 1129414573 15:75368213-75368235 CCGGTGGGCACATGCTGGAGGCC 0: 1
1: 0
2: 0
3: 30
4: 216
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1129414585_1129414591 -6 Left 1129414585 15:75368248-75368270 CCTGGGGGCCAGCTGGCCGGTGG 0: 1
1: 0
2: 1
3: 26
4: 276
Right 1129414591 15:75368265-75368287 CGGTGGGGCCGCACTTTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129414591 Original CRISPR CGGTGGGGCCGCACTTTCCC TGG Intronic